SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
javascript still not working merkutinaa RNA Sequencing 2 03-13-2014 11:00 AM
Working in MiReap njsphd Bioinformatics 1 01-03-2014 09:13 AM
JIGSAW not working volavii Bioinformatics 2 10-22-2013 07:42 AM
Estimate tophat2 parameters from rnaseq data? angerusso RNA Sequencing 0 04-16-2013 12:13 PM
working in polyscan awalisa Bioinformatics 0 02-23-2012 08:01 PM

Reply
 
Thread Tools
Old 05-28-2014, 03:43 PM   #1
statsteam
Member
 
Location: Californica

Join Date: Sep 2009
Posts: 19
Default tophat2 some parameters are not working (--no-novel-indels and -a)

I used tophat2 to map reads with --no-novel-indels and -a 6 parameters. Once the mapping is done, I examined the result (accepted_hits.bam) and found some lines with indels or some lines whose anchor length < 6.

## with insertion
SRR074943.46688543 369 chr1 10178 0 21M2I27M chr14 69256332 0 CCTAACCCTAACCCTAACCCTAAAACCCTAACCCTAACCCTAACCCTAAC <<;@=ABA=A=BAB7B8B>B?ABA=BBB4B8BBB<B8BBC?B=BBCABBB AS:i:-11 XN:i:0 XM:i:0 XO:i
:1 XG:i:2 NM:i:2 MD:Z:48 YT:Z:UU NH:i:16 CC:Z:= CP:i:10184 HI:i:0


## anchor length < 6
SRR074943.63823907 329 chr1 14825 0 5M140N45M * 0 0 GATGCCCTTGCGCCTCATGACCAGCTTGTTGAAGAGATCCGATATCAAGT BBBBBBBBBB?A@@B@>BB?:><<?@@?=?<:9@<6:=65:?:7:=:=4, AS:i:-4 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:42C7 YT:Z:UU XS:A:- NH:i:7 CC:Z:c
hr15 CP:i:102516151 HI:i:0


There are a lot of lines like these. I am wondering if anyone else had the same problem as this or I did something wrong in running tophat.

This is the command line I used to run tophat2

tophat -o tophat_out -N 3 -r 30 --mate-std-dev 110 -a 6 -I 300000 -p 8 -g 20 --no-novel-indels --no-coverage-search hg19_index read_1.fastq read_2.fastq

Thank you!

Last edited by statsteam; 05-28-2014 at 03:48 PM. Reason: putting a correct example for anchor length <6
statsteam is offline   Reply With Quote
Old 05-28-2014, 04:45 PM   #2
statsteam
Member
 
Location: Californica

Join Date: Sep 2009
Posts: 19
Default

I figured out -a 6 parameter issue. It does not ensure individual read to have at least x bps on each side of junction. Instead, it ensures that each junction to have at least one read that meet the anchor condition. If -a 6 is used, each junction must have reads that spans at least 6bps on each side of junction.

I still do not know why --no-novel-indels does not work.
statsteam is offline   Reply With Quote
Reply

Tags
anchor, indel, parameter, tophat 2

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:24 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO