SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
HTSeq error using STAR alignments bioBob RNA Sequencing 8 10-13-2016 08:37 AM
tophat running error figo1019 Bioinformatics 9 05-03-2013 07:18 AM
TopHat error - error running prep_reads ajaffe RNA Sequencing 0 11-29-2012 07:09 AM
annovar running error gary Bioinformatics 2 12-15-2011 06:25 AM
tophat Error running running 'prep_reads' victoryhe Bioinformatics 2 10-17-2011 04:53 AM

Reply
 
Thread Tools
Old 10-06-2014, 02:33 PM   #1
JJZ
Junior Member
 
Location: Cleveland

Join Date: Aug 2014
Posts: 4
Default error running STAR

I am using STAR to map my paired end rna seq data. I keep running into the following error msg.
EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >
This was my command line:
-bash-3.2$ /pathToStarDir/ STAR --genomeDir /pathToGenome/ --readFilesCommand zcat --readFilesIn /pathToFile/587352_1_1.fastq.gz pathToFile/587352_1_2.fastq.gz --runThreadN 3

When I zless my .fastq.gz file to check the format of the file, the first few lines looks like this:
@HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
GCTGTATCTCTCAGGATTATCACTGATCACACATCCAACCAGTGCCAGCCAAAAGGATGCCCTGAGGCAAAGGGT
+HWI-ST152R_0409:5:1:1451:1993#NAGCTT/1
bbd_dee`dcdfefffffeffffffaeeeefdfffffefffeeefeffffffefcffcefffeffadfedbbTcU
@HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
GGCCATCTGATCTATAAATGCGGTGGCATCGACAAAAGAACCATTGAAAAATTTGAGAAGGAGGCTGCTGAGATG
+HWI-ST152R_0409:5:1:1587:1992#TAGCTT/1
gecgggggggffgdggfgggfffgddedfbecbcdadfadeg^eaedda^g`cdbdggdgdV^a`X`_``W]V]c

Has anyone ran into similar problems before? Is it a file problem or there was mistakes in my command ?

Thanks for the help in advance.

J.Z
JJZ is offline   Reply With Quote
Old 10-06-2014, 04:12 PM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,784
Default

Can you try Brian's repair.sh tool to see if you can fix problems with your fastq files: http://seqanswers.com/forums/showpos...0&postcount=45 I am not sure if it will catch malformed ID headers.

Alternatively fastqValidator can be used to see if you do have a problem with formatting: http://genome.sph.umich.edu/wiki/FastQValidator
GenoMax is offline   Reply With Quote
Old 10-06-2014, 05:31 PM   #3
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I don't see a problem with the first 8 lines, at least. And yes, repair.sh requires correctly-formatted fastq headers; it's only for fixing broken pair ordering. I'm not familiar with how STAR deals with gzipped files, but perhaps you could try decompressing it first?
Brian Bushnell is offline   Reply With Quote
Reply

Tags
error, file format, star

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:35 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO