SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq sequencing primer question enum Illumina/Solexa 1 07-13-2016 06:25 AM
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 11:52 AM
Miseq custom primer design, primer linker Cyrus Taheri Illumina/Solexa 1 04-21-2015 05:25 PM
MiSeq Index Primer Sequence krispy Illumina/Solexa 3 12-26-2013 02:31 AM
Miseq illumina primer rozitaa General 1 06-04-2013 03:02 AM

Reply
 
Thread Tools
Old 02-08-2018, 10:17 AM   #1
tomlodz
Member
 
Location: Poland

Join Date: Jul 2017
Posts: 10
Default Miseq primer cocktail

Hello,

Where to find the exact oligonucleotide sequence of primers for (Read1, Index1 and Read2) which are in the Miseq Kits V2.

I tried to find this information in different places but without a result.

I use custom protocol for library preparation. I use following adapters P5, P7

P5 ACACTCTTTCCCTACACGACGCTCTTCCGATCT

P7 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

My question is do I have to use custom primers for sequencing or I can use those from the Miseq V2 kit.

Thanks in advance for your help
tomlodz is offline   Reply With Quote
Old 02-08-2018, 01:43 PM   #2
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,178
Default

Illumina sequencing primer mixes are proprietary.
If those are full length sequences of your adapter oligos, your library fragments will not cluster as they are missing flow cell binding motives necessary for bridge amplification. Your P7 sequences is incorrect for adapter oligo unless it is amplification primer.
nucacidhunter is offline   Reply With Quote
Old 02-08-2018, 11:31 PM   #3
tomlodz
Member
 
Location: Poland

Join Date: Jul 2017
Posts: 10
Default

No this are adapters before library idexing.

Whole adapters after indexing reaction look like this:

Adapter P5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

Adapter P7 CAAGCAGAAGACGGCATACGAGATcctgcgaGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

This set of adapters is very similar to TruSeq LT Kit from Illumina.
tomlodz is offline   Reply With Quote
Old 02-09-2018, 01:17 AM   #4
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,178
Default

You library should sequence on MiSeq and there is no need for custom sequencing primers.
nucacidhunter is offline   Reply With Quote
Old 02-09-2018, 01:23 AM   #5
tomlodz
Member
 
Location: Poland

Join Date: Jul 2017
Posts: 10
Default

Thank You very much.
tomlodz is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:41 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO