SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cutadapt: A tool that removes adapter sequences mmartin Bioinformatics 132 05-19-2016 07:09 AM
cutadapt quality trimming cutoff algorithm bongbimit Bioinformatics 1 08-13-2014 08:36 AM
3' trimming using cutadapt changes property of 5'. Alex Lee RNA Sequencing 0 04-17-2014 10:28 PM
Adapters trimming: Cutadapt vs Trimmomatic MafaldaSF Bioinformatics 8 03-20-2014 06:16 AM
Using CASAVA versus cutadapt for adapter trimming id0 Bioinformatics 0 08-08-2013 09:39 AM

Reply
 
Thread Tools
Old 05-04-2015, 05:01 AM   #1
Kulvait
Member
 
Location: Czech Republic

Join Date: Aug 2012
Posts: 10
Default Adapter trimming with cutadapt

Hi,
can you please give me an advice. I have paired end sequencing data from amplicon sequencing using TruSeq adaptors (and some barcoding using Myeloid panel Illumina kit).

I have noticed using FastQC that there are many reads that have contamination by Illumina universal adapter in R2 but not in R1. I quite do not understand the fact that there is such disproportion. So maybe I am missing something such as reverse complement the reads from R1 or adapter sequence.

However knowing that adapter sequence starts with AGATCGGAAGAG (I guess for both adapters) is it sufficient to remove adapters by this command?

cutadapt -a AGATCGGAAGAG -A AGATCGGAAGAG -o out.1.fastq -p out.2.fastq IN_R1_001.fastq IN_R2_001.fastq

Thank you,
Vojtech.
Kulvait is offline   Reply With Quote
Old 05-04-2015, 04:51 PM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,668
Default

Adapter sequence for fragment libraries should always appear at the exact same location in R1 as in R2 for a given pair. Thus adapter-trimmed paired reads should come out with R1 and R2 being the same length.

If you are not sure what your adapter sequence is, you can find out with BBMerge (post #48). 12bp is kind of short for adapter removal, particularly if mismatches are allowed.
Brian Bushnell is offline   Reply With Quote
Old 05-05-2015, 03:41 AM   #3
Kulvait
Member
 
Location: Czech Republic

Join Date: Aug 2012
Posts: 10
Default

Thank you,
you pointed me out in a good direction.

Acording to extensive analysis of supplied files I have found out adapter sequences:
Read1 :GCGAATTTCGACGATCGTTGCATTAACTCGCGA
Read2 :AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

resulting in a command
cutadapt -a GCGAATTTCGACGATCGTTGCATTAACTCGCGA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT -o /dev/null -p /dev/null R1.fastq R2.fastq

I am also considering using trimmomatic.

I have barcoded sequences. And the automatic detection would be good. The problem with my data is that Illumina (or my sequencing facility in their name) refused to confirm adapter sequences. I know that the data are coming from http://www.illumina.com/products/trusight-myeloid.html and are barcoded using Illumina barcodes. Adaptor contamination is present only in a proportion of my files. In some files they are not present.

I promise to test my data with your tool if the detection is correct. The problem is that I do not understand how to supply first pair reads and how second pair reads. And how your tool will figure out where to put N's for barcode when I supply only one sample barcoded with only one barcode. I have approximately 96 samples sequenced in one run, multiplexed. All samples (same library) were sequenced on the two lanes as paired end experiment. Thus I have 4 files for each sample. If you are interested in testing your program on these data I am interested. PM me.

Another Issue will be to remove primer sequences from the reads and then it would be nice to use FASTX or your software to cover whole amplicon with a read. But I doubt that using such tools is of no benefit when primer sequences are present in the data.

Vojtech.
__________________
Data analysis www.persmed.eu
Kulvait is offline   Reply With Quote
Old 05-05-2015, 03:48 AM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,439
Default

Vojtech: Both BBDuk (part of BBMap) and trimmomatic include sequence files for standard illumina adapters.

With BBDuk if you're not sure which adapters are used, you can add "ref=truseq.fa.gz,truseq_rna.fa.gz,nextera.fa.gz" to your command line and get them all (this will increase the amount of overtrimming, though it should still be negligible).
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:18 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO