SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
ATAC-seq protocol wen yuan Sample Prep / Library Generation 69 02-22-2018 08:01 AM
ATAC seq lysis time zoe561 Sample Prep / Library Generation 3 03-05-2015 09:00 AM
Rn/cycles: qPCR decided ATAC-seq library amplification zhaolin Sample Prep / Library Generation 6 01-28-2015 01:23 PM
Primers for qPCR validation in non-model RNA-Seq lzsph RNA Sequencing 2 11-09-2012 08:09 PM
Enrich and Seq primers at RT overnight? gfpumpkins 454 Pyrosequencing 2 05-23-2012 07:54 AM

Reply
 
Thread Tools
Old 02-06-2015, 02:51 AM   #1
Fasteno
Junior Member
 
Location: Oxford

Join Date: Nov 2014
Posts: 4
Question ATAC-seq primers

Hi guys,

I'm a newbie about the ATAC-seq, maybe here there is someone more expert than me.

I'm doing an ATAC-seq on my samples (I have 3 different samples form thymic epithelium), and I'm a bit stucked about how to amplify my tagmented DNA. I've seen the primers list from Greenleaf lab (Supplemental table from the article), but now I have no idea of how to use those primers. Do I have to use all of them? I need to mix them?

Sorry if it's a stupid question. Science is infinite knowledge!

thank you very much for your help.
Fasteno is offline   Reply With Quote
Old 02-10-2015, 12:44 PM   #2
newmoon
Member
 
Location: usa

Join Date: Oct 2010
Posts: 10
Default

you use a PCR Primer 1 (Ad1_noMX) and an indexed PCR primer 2 (Ad2.1_... or Ad2.2_...or any index you like from the list) for each of your sample.

Use different index primers for different samples,so your samples can be sequenced together.

Do not mix the primers.
newmoon is offline   Reply With Quote
Old 07-25-2015, 10:37 PM   #3
Hedgehog
Junior Member
 
Location: Australia

Join Date: Jul 2015
Posts: 2
Default

Hi guys,

In the ATAC-seq protocol, they said you can do a qPCR with Nextra Custom Design primers 1 and 2, are these primers Ad1_noMX and indexed primer 2 (what we use initially to do library amplification?) Or are these primers part of the Nextra Kit (FC-121-1030). like generic primers?

Thanks very much!!!
Hedgehog is offline   Reply With Quote
Old 09-09-2015, 04:38 AM   #4
Fasteno
Junior Member
 
Location: Oxford

Join Date: Nov 2014
Posts: 4
Default

Hi Hedgehog,

I oredered primers from Sigma, and they worked fine!
Ciao!
Fasteno is offline   Reply With Quote
Old 01-22-2016, 01:58 AM   #5
martiferno
Junior Member
 
Location: Spain

Join Date: Jan 2016
Posts: 2
Default

Quote:
Originally Posted by Fasteno View Post
Hi Hedgehog,

I oredered primers from Sigma, and they worked fine!
Ciao!
Hello,

Could you help me with the primers? I am trying to order it to Sigma, with the PCR Primer 1 (Ad1_noMX) I haven´t got problems because it is a normal primer but with the PCR primer 2 Ad2.1 that must be BARCORDE, could you help how I have to order the BARCODE of the primer?
Thank you in advance. Your help would be very grateful

=D
martiferno is offline   Reply With Quote
Old 01-22-2016, 04:01 AM   #6
martiferno
Junior Member
 
Location: Spain

Join Date: Jan 2016
Posts: 2
Default

Thank you so much,

My email is [email protected]
martiferno is offline   Reply With Quote
Old 04-04-2016, 11:39 AM   #7
paramita7
Junior Member
 
Location: atlanta

Join Date: Jan 2016
Posts: 6
Default sigma has .2-1uM range for adapter sequences

In atac-seq protocol they say 25uM of primer but sigma has .2-1um range. Can you tell how you ordered.Thanks,
paramita7 is offline   Reply With Quote
Old 01-20-2017, 03:05 PM   #8
kropak1807
Junior Member
 
Location: Tallahassee, FL

Join Date: Jan 2017
Posts: 6
Default How to order ATAC-seq primers

I am about to order the Nextera DNA prep kit (24 samples) from illumina.

I also need to order the primers (the ones in Supplementary Table 1 in the Nat Protocols paper) but I am new at this and want to make sure i do it correctly... do these primers need to be specially ordered in any way (ie. HPLC purified, etc.) and what concentration should i request?
kropak1807 is offline   Reply With Quote
Old 04-03-2018, 02:14 PM   #9
Laiumiunix
Junior Member
 
Location: California

Join Date: Apr 2018
Posts: 4
Default

HI,

I'm a little confused how to orders the primers too:
Just to be sure if I understand:

For each sample:

I will need:

Sample1
Ad1_noMX:
Ad2.1_index

Sample2
Ad1_noMX:
Ad2.2_index:

etc
In terms to order the primers if I follow the list from (Jason D Buenrostro paper):

I should be order:

Ad1_noMX: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG


Basically the second primer I have to put the index sequence to order:
index+sequence?
Ad2.1_TAAGGCGA: TAAGGCGA-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT


Thanks
Laiumiunix is offline   Reply With Quote
Old 04-09-2018, 11:04 AM   #10
kropak1807
Junior Member
 
Location: Tallahassee, FL

Join Date: Jan 2017
Posts: 6
Default ATAC-seq primers

That is correct

Here, order these:

Purification - NGS-grade (although DESALT worked for me as well)

AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG - Ad1_i5_noMX
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT - Ad2.1_TAAGGCGA

CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT - Ad2.2_CGTACTAG

CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT - Ad2.3_AGGCAGAA

CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT - Ad2.4_TCCTGAGC

CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT - Ad2.5_GGACTCCT

CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT - Ad2.6_TAGGCATG
kropak1807 is offline   Reply With Quote
Old 04-09-2018, 11:38 AM   #11
Laiumiunix
Junior Member
 
Location: California

Join Date: Apr 2018
Posts: 4
Default

Quote:
Originally Posted by kropak1807 View Post
That is correct

Here, order these:

Purification - NGS-grade (although DESALT worked for me as well)

AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG - Ad1_i5_noMX
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT - Ad2.1_TAAGGCGA

CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT - Ad2.2_CGTACTAG

CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT - Ad2.3_AGGCAGAA

CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT - Ad2.4_TCCTGAGC

CAAGCAGAAGACGGCATACGAGATAGGAGTCCGTCTCGTGGGCTCGGAGATGT - Ad2.5_GGACTCCT

CAAGCAGAAGACGGCATACGAGATCATGCCTAGTCTCGTGGGCTCGGAGATGT - Ad2.6_TAGGCATG
Just a quick question the final primer that you order is:
For example:

For:
Ad2.1_TAAGGCGA
- CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

Did you add the index:
Basically, the primer sequence I have to order is:
This one for ad2.1:
TAAGGCGACAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT

or this one:

CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT


Thanks
Laiumiunix is offline   Reply With Quote
Old 04-09-2018, 11:48 AM   #12
kropak1807
Junior Member
 
Location: Tallahassee, FL

Join Date: Jan 2017
Posts: 6
Default ATAC-seq primers

No, you do not add the sequence at the beginning of the primer.

Look closely,

CAAGCAGAAGACGGCATACGAGAT[8mer_index]GTCTCGTGGGCTCGGAGATGT-3’

The 8mer_index is the Index sequence complement.

So, for the sequences I posted, they already have the 8mer index (complement) in them.

Order the primers exactly as I posted them. Use the Index ID in the primer name to demultiplex your reads.
kropak1807 is offline   Reply With Quote
Old 04-09-2018, 11:51 AM   #13
Laiumiunix
Junior Member
 
Location: California

Join Date: Apr 2018
Posts: 4
Default

Quote:
Originally Posted by kropak1807 View Post
No, you do not add the sequence at the beginning of the primer.

Look closely,

CAAGCAGAAGACGGCATACGAGAT[8mer_index]GTCTCGTGGGCTCGGAGATGT-3’

The 8mer_index is the Index sequence complement.

So, for the sequences I posted, they already have the 8mer index (complement) in them.

Order the primers exactly as I posted them. Use the Index ID in the primer name to demultiplex your reads.
Thanks a lot.
Laiumiunix is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:30 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO