SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
paired-end adapter trimming vinay052003 Bioinformatics 16 05-02-2017 07:58 PM
how to define a forward or reverse read file poorphd Illumina/Solexa 3 11-22-2011 12:34 PM
Difference in paired-end and single-end read ? darshan Bioinformatics 1 09-30-2009 11:44 PM
bias in mapped forward/reverse read ratios dvh Illumina/Solexa 8 10-02-2008 07:32 AM

Reply
 
Thread Tools
Old 03-01-2012, 07:46 PM   #1
darthsequencer
Member
 
Location: california

Join Date: Feb 2012
Posts: 35
Unhappy Forward adapter at end of forward paired end read?

So I was given a metatranscriptome prepped with the Nugen Ovation RNAseq kit.

The metatranscriptome was sequenced on a HiSeq 2000 paired end.

In the first read a lot of the sequences ~20% have the forward adapter at the end of the read - this is it's sequence:
GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC

I'm just wondering what could cause this -
Here's an example read with the adapter in it. If anything shouldn't it be at the front of the read? Why would it be at the end and why is there still more sequence after it?

GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC

Thanks
darthsequencer is offline   Reply With Quote
Old 03-04-2012, 01:37 PM   #2
BAMseek
Senior Member
 
Location: St. Louis, MO, USA

Join Date: Apr 2011
Posts: 124
Default

Reading into the adapter sequence can happen when the fragment size is less than the read length. This would show up as a partial adapter sequence at the 3' end (right side) of a read, as you have observed. There are quite a few tools out there that will trim the adapter portion of a read (see here for a discussion, and also search for threads here on seqanswers). I'm not sure how well these tools deal with reads that go through the entire adapter sequence and beyond - one possibility might be to pad the 3' end of the adapter sequence with Ns before running one of these tools.
BAMseek is offline   Reply With Quote
Reply

Tags
adapter, forward, illumina, paired

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:09 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO