SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
File "/usr/lib64/python2.4/logging/__init__.py", line 718, twotwo Bioinformatics 3 08-02-2013 12:39 PM
"allele balance ratio" and "quality by depth" in VCF files efoss Bioinformatics 2 10-25-2011 11:13 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM
TopHat "accepted_hits.sam" header line sunnyvu Bioinformatics 1 04-02-2010 08:05 AM
SEQanswers second "publication": "How to map billions of short reads onto genomes" ECO Literature Watch 0 06-29-2009 11:49 PM

Reply
 
Thread Tools
Old 06-08-2012, 03:29 PM   #1
doublealice
Member
 
Location: US

Join Date: Feb 2011
Posts: 24
Default [solved]"#" in illumina reads fastq quality line

Hi all,

I am using prinseq to trim low quality tail of illumina reads. From the manual, I found -trim_qual_left and -trim_qual_right can trim seq by quality score from the 5' or 3' -end with certain threshold score. So, here are parameters I used:

Code:
#trim 
-trim_qual_right 33
-trim_qual_left 33
I am not sure whether I chose correct parameter and whether 33 is too high.

In addition, I also used below two to trim polyA/T
Code:
 
-trim_tail_right 10
-trim_tail_left 10
When program was running, I checked the filtered out reads in so called 'bad_reads" file, I found the quality lines of most of reads contain a very long "#########", some of them even have entire line of #, e.g:

Code:
@HWI-ST538:217:C0NFWACXX:4:1101:19625:1943 1:Y:0:GAGTGG
CNCGTCCCTTGATATGTTGTAATTCGTCTTTCATTTCCATTATGATGGCATCTGCAGCATCCTGCCAGAGACCTTTCAGATGAATATTTTCTTGCTGCAA
+
####################################################################################################
@HWI-ST538:217:C0NFWACXX:4:1101:20481:1941 1:Y:0:GAGTGG
TNCATACTTTCGTTCCTTTCTCTTTATACGGATCGACTTCGTTCCAAGCTGTGGGAATCTTGACCGTGTTGTGCATCAGGGGTCATCTGCTTCGGTCATT
+
3#02===@8<@?@7:=@?)>:>><>>@?9???8?4((--<(97<;):)7>7>???9?>???>)<>=99=?##############################
@HWI-ST538:217:C0NFWACXX:4:1101:20349:1946 1:Y:0:GAGTGG
CNGCGCTGCTGCCAACTAGTAAAGGAAGTATTCATTAAAATGCAGGGAGACCGCAGGAATGGGGACATGTTCCCCTTTGGGGACCCTTTTGGCAGCTTCG
+
;#0@-55=?<>>>??9??>.8=9>@>@<?>?=?>?>????>?>?<<=5=???<??<?9>?########################################
I am not quite clear the meaning of symbols in quality. Does multiple "#" really mean these sequences are bad? In "good reads" file, none of read contain "#" in its quality. I am afraid that I did anything wrongly and discard read which should be kept.

The version is illumina 1.9 based on fastQC.

Any advice is highly appreciated.

-alice

Last edited by doublealice; 06-09-2012 at 03:18 PM.
doublealice is offline   Reply With Quote
Old 06-09-2012, 06:47 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Since you have data from Illumina 1.9 this is using the Sanger FASTQ encoding, so '#' (ASCII 66) means PHRED quality 2 which has a special meaning with Illumina as the "Read Segment Quality Control Indicator". Under the old Illumina FASTQ encoding Q2 was a 'B'.

See http://seqanswers.com/forums/showpos...91&postcount=3

i.e. the run of PHRED 2 means the read failed in some specific way according to the Illumina software. Even without this knowledge, PHRED quality 2 is very bad and should be clipped/discarded.
maubp is offline   Reply With Quote
Old 06-09-2012, 03:18 PM   #3
doublealice
Member
 
Location: US

Join Date: Feb 2011
Posts: 24
Default

maubp, thanks very much. This is very helpful.
doublealice is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:42 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO