SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to mask and not remove "adapter" sequence? GeGnome Bioinformatics 3 09-09-2015 05:41 AM
MiSeq gDNA reads still fail "Kmer content" and "per base seq content" after trimming" ysnapus Illumina/Solexa 4 11-12-2014 07:25 AM
Do not use "adapter trimming" in MiSeq Reporter 2.0.25 ECO Illumina/Solexa 9 12-10-2013 04:38 AM
The position file formats ".clocs" and "_pos.txt"? Ist there any difference? elgor Illumina/Solexa 0 06-27-2011 07:55 AM
"Systems biology and administration" & "Genome generation: no engineering allowed" seb567 Bioinformatics 0 05-25-2010 12:19 PM

Reply
 
Thread Tools
Old 08-30-2015, 02:19 PM   #1
Bubblepig
Member
 
Location: Montreal

Join Date: Mar 2013
Posts: 13
Default Custom trimming of "staggered" adapter sequences

Hello!

I have a question pertaining to the trimming of custom/staggered adapter sequence in a FASTQ file.

I have a library with 4 different adapter lengths on the 5' side; this was done to increase library diversity during sequencing. However now I want to trim off the adapter and I can't do it by length!

Here's the 4 potential adapter sequence:

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCGGGGACTTATCAGCCAACC

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNCGGGGACTTATCAGCCAACC

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNCGGGGACTTATCAGCCAACC

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNCGGGGACTTATCAGCCAACC

And now I would like to trim off all “CGGGGACTTATCAGCCAACC” (and everything upstream!) from my reads - does anyone know how I can do it?

Thanks a lot for any help! Please let me know if further information is needed.

Joyce
Bubblepig is offline   Reply With Quote
Old 08-31-2015, 05:09 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,062
Default

BBDuk.sh should be able to do it with "k=20 ktrim=l literal=CGGGGACTTATCAGCCAACC" options. Add other options as needed.

Last edited by GenoMax; 08-31-2015 at 05:22 AM.
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:09 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO