SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
HTSeq sort sam DZhang Bioinformatics 41 11-03-2014 12:36 AM
Cufflinks sample file(test_data.sam) output snp_analyser Bioinformatics 0 06-07-2010 07:38 AM
.sam file downloading problem from modENCODE wenrongzeng Bioinformatics 0 04-15-2010 01:38 PM
Is anyone having trouble with tophat's SAM file -> cufflinks? peterlchang Bioinformatics 5 03-10-2010 07:17 PM
SAM file flag problem ptong7 Bioinformatics 4 07-30-2009 04:32 AM

Reply
 
Thread Tools
Old 09-13-2010, 09:53 AM   #1
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default Cufflinks SAM file sort problem

The Cufflinks manual states that SAM files should be sorted according to the following:
Code:
sort -k 3,3 -k 4,4n hits.sam > hits.sam.sorted
However, when I sort this way, the chromosomes are sorted something like this:
Code:
chr1
chr11
[...]
chr19
chr2
chr20
chr3
[...]
chr9
I assume the intention of the sort is to end up with chr1 ... chr20, chrX, in numerical order? If so, how can I achieve this? I tried using various flags for field 3, and I also tried making "chr" a delimiter, but it seems delimiters must be one character long.

I've been running Cufflinks with my SAM files ordered like this, but I've no idea if it will make a difference or not.

Note: I started with Bioscope BAM files (PE, strand-specific), which were converted to SAM with SAMtools. The 'XS:A:' field was added based on strand info from field 2. A sample of my SAM files is below:
Code:
1384_723_1125   0       chr1    121     0       25M     *       0       0       CATTTTCCTCTAGAGTCAGAAACGN       IH8IIIIIIIIIEII77IIIIHEI!
       NH:i:0  RG:Z:20100828211420290  CS:Z:G3130002022232221112200133 CQ:Z:BB'2BBB?2BB?42BB776BA:/75  SM:i:0  CM:i:2  XS:A:+  
200_1536_1533   73      chr1    7467    1       18H28M4H        *       0       0       GTTTTTCCTAATTTGATATTTAAAAAAA    //-.2.**787;033""".*)--4F>.,    NH:i:0  RG:Z:20100828211420290  CS:Z:T12132211201311202001000020230300122130030000002000        CQ:Z:6??<=?><;A;AA?/-%,)')%*)&%&2'1+&.&%))&%%)%07('&2-* SM:i:2  CM:i:2  XS:A:+  
2234_1292_1060  129     chr1    8334    33      25M     chr8    47073575        0       GAGATCCCCAAGAATCCTTACCTTT       +EIII))))519IIIA5:8/%:D4&       NH:i:1  RG:Z:20100828211420290  CS:Z:G0222320001022032020320200 CQ:Z:'%ABB<)=>)-%5=B=%1*/<%6/&  SM:i:1  CM:i:3  XS:A:+  
21_385_199      89      chr1    10073   0       3H27M20H        *       0       0       AGCCCCGAAAAAAAAAATAAATATCAG     72/@I91=B?@4/03E@<II%%,/(0I     NH:i:0  RG:Z:20100828211420290  CS:Z:T01223203301132231023222233100330000000002300032030        CQ:Z:&,87'*/%%%.*-((/%&+*5:0((%%684)8.&+%01/4*(28)',,)6 SM:i:3  CM:i:2  XS:A:-
Can anyone clarify this issue for me? Thanks.
AdamB is offline   Reply With Quote
Old 09-13-2010, 10:37 PM   #2
GKM
Member
 
Location: Pasadena, CA

Join Date: May 2009
Posts: 45
Default

If cufflinks runs then you shouldn't have any problems arising from the sorting. It sorted the chromosomes as strings, not as numbers, but as long as the positions are sorted numerically, it should be fine, and they are (it would have given you an error otherwise)
GKM is offline   Reply With Quote
Old 09-14-2010, 02:44 AM   #3
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Thanks for your reply. I wasn't sure whether Cufflinks would continue in the wrong way or give an error message, had it been wrong.
AdamB is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:41 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO