Hi,
If I am right, bowtie options -n 0 -l 16 should not allow any mismatches in the seed region of 16. But the following result is puzzling me.
I am aligning sequencing reads using the above options to miRNA sequences.
In SAM format output, I can find some lines with mismatches right in the beginning. Why is this?
I suppose the field containing "MD:" denotes the positions of mismatches. For the first record, there is a mismatch in the first position and for the second one, there is mismatch on the 26th position. For the above options, bowtie should not report mismatches in the seed region, then why is this happenning. Or Am I reading it wrongly?
2_1977_1917_F3 16 106b 23 255 48M * 0 0 GCGTTTCCGGACTACATCGGCGAACCTGATCTGCACTGTCAGCACTTT qqqqqqqqqqqq!!qqqqqqqqq!!qqqqqq!!qqqqqqqqqqqqqqq XA:i:0 MD:Z:0A1A0G1G1G1T1G0C2G0G0A1A0G2C1A0C0T20 NM:i:17 CM:i:27
2_1977_1040_F3 0 7-3 32 255 48M * 0 0 GGAAGACTAGTGATTTTGTTGTTCTAAGGTTTTACGACTACAATTCCC qqqqqqqqqqqqqqqqqqqqqqq!!qqqqqqqqqq!!qqq!!qqqqqq XA:i:0 MD:Z:25G1T2A0C6A4G2A1 NM:i:7 CM:i:16
If I am right, bowtie options -n 0 -l 16 should not allow any mismatches in the seed region of 16. But the following result is puzzling me.
I am aligning sequencing reads using the above options to miRNA sequences.
In SAM format output, I can find some lines with mismatches right in the beginning. Why is this?
I suppose the field containing "MD:" denotes the positions of mismatches. For the first record, there is a mismatch in the first position and for the second one, there is mismatch on the 26th position. For the above options, bowtie should not report mismatches in the seed region, then why is this happenning. Or Am I reading it wrongly?
2_1977_1917_F3 16 106b 23 255 48M * 0 0 GCGTTTCCGGACTACATCGGCGAACCTGATCTGCACTGTCAGCACTTT qqqqqqqqqqqq!!qqqqqqqqq!!qqqqqq!!qqqqqqqqqqqqqqq XA:i:0 MD:Z:0A1A0G1G1G1T1G0C2G0G0A1A0G2C1A0C0T20 NM:i:17 CM:i:27
2_1977_1040_F3 0 7-3 32 255 48M * 0 0 GGAAGACTAGTGATTTTGTTGTTCTAAGGTTTTACGACTACAATTCCC qqqqqqqqqqqqqqqqqqqqqqq!!qqqqqqqqqq!!qqq!!qqqqqq XA:i:0 MD:Z:25G1T2A0C6A4G2A1 NM:i:7 CM:i:16
Comment