Hi Guys,
I downloaded a RNAseq data from http://www.ncbi.nlm.nih.gov/geo/quer...?acc=GSM543645.
You can see after sequencing it being mapped to a genome by using
Seqmap34. I have no idea about Seqmap34 at all. Anyone happended to know Seqmap34 output description?
I took one line here:
HWI-EASXXX:1:60:470:949#0/1 CCTCTCCTGCTTGAGCTGCTCAAACTTCCGCTTCAG 2:1:0:0 NM_130881:Pabpc4:1530R0,NM_148917:Pabpc4:1156R0,NR_002862:EG328451:829F1
what does each part describe?
Thanks
I downloaded a RNAseq data from http://www.ncbi.nlm.nih.gov/geo/quer...?acc=GSM543645.
You can see after sequencing it being mapped to a genome by using
Seqmap34. I have no idea about Seqmap34 at all. Anyone happended to know Seqmap34 output description?
I took one line here:
HWI-EASXXX:1:60:470:949#0/1 CCTCTCCTGCTTGAGCTGCTCAAACTTCCGCTTCAG 2:1:0:0 NM_130881:Pabpc4:1530R0,NM_148917:Pabpc4:1156R0,NR_002862:EG328451:829F1
what does each part describe?
Thanks