SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Ion Torrent



Similar Threads
Thread Thread Starter Forum Replies Last Post
RAPID Libraries adaptor+key sequences dottomarco 454 Pyrosequencing 15 01-14-2021 12:56 AM
Adaptor sequences RNA seq -remove? sebastion RNA Sequencing 1 07-31-2012 11:00 AM
P1 adaptor vs. Multiplex P1 adaptor hfaoro SOLiD 0 03-26-2012 06:54 AM
Make a complete genome sequences from Illumina data nhbach Illumina/Solexa 2 08-30-2011 06:58 PM
Problems with small RNA adaptor sequences chris Bioinformatics 0 09-16-2010 09:04 AM

Reply
 
Thread Tools
Old 08-07-2012, 07:41 AM   #1
Apex
Junior Member
 
Location: Denmark

Join Date: Mar 2011
Posts: 4
Question Complete ligation adaptor sequences

Hello everyone,

I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

Forward primer (Primer A-key):
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
Reverse primer (Primer P1-key):
5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

Does anyone have this sequence of the ligation adaptors?

I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.
Apex is offline   Reply With Quote
Old 08-07-2012, 08:01 AM   #2
genseq
Member
 
Location: Russia

Join Date: Dec 2007
Posts: 88
Cool

Quote:
Originally Posted by Apex View Post
Does anyone have this sequence of the ligation adaptors?
Ion A Adapter (non-barcoded)

....5'—CCATCTCATCCCTGCGTGTCTCCGACTCAG–3'
3'—T*T*GGTAGAGTAGGGACGCACAGAGGCTGAGTC-5'


Ion P1 Adapter

....5'—CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT–3'
3'—T*T*GGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTA-5'


http://seqanswers.com/forums/attachm...1&d=1343464421
genseq is offline   Reply With Quote
Old 08-08-2012, 01:09 AM   #3
Apex
Junior Member
 
Location: Denmark

Join Date: Mar 2011
Posts: 4
Default

Exactly what I was looking for! Thank you very much genseq!
Apex is offline   Reply With Quote
Old 08-08-2012, 08:17 AM   #4
IonTorrent
Member
 
Location: Guilford, CT and S.F., CA

Join Date: Jan 2010
Posts: 64
Default

Hi Apex,

The sequences of the fragment library adaptors can be found in Appendix D (pp. 45) of the current Ion Xpress™ Plus gDNA Fragment Library Preparation User Guide, as available on the Ion Community.

Ion AmpliSeq™ Custom Panels may be designed using the Ion AmpliSeq™ Designer website.


Quote:
Originally Posted by Apex View Post
Hello everyone,

I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq:

Forward primer (Primer A-key):
5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’
Reverse primer (Primer P1-key):
5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’

For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR.

Does anyone have this sequence of the ligation adaptors?

I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself.
IonTorrent is offline   Reply With Quote
Old 01-14-2016, 05:56 AM   #5
JoF
Junior Member
 
Location: Germany

Join Date: Aug 2014
Posts: 2
Default adaptor sequences for Ion S5

Hi,
I'm new to Life Tech semi conductor Sequencing and only have MiSeq experience. We were offered a demo run of the Ion S5 and I would like to produce the library beforehand with our custom protocol.

Can anyone tell me if the Ion torrent adaptors are the same for the Ion S5?

Fwd: CCATCTCATCCCTGCGTGTCTCCGACTCAG

Rev: CCTCTCTATGGGCAGTCGGTGAT

cheers,
JoF
JoF is offline   Reply With Quote
Reply

Tags
adaptor sequence

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:40 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO