Hi I'm wondering if anyone knows what adapters to filter for with data generated from Rapid library prep, titanium 454 sequencing. There seems to be lots of information about Illumina adapters around but having a hard time finding ones for 454.
I am finding variants of the following sequence as it's own or at the end of reads in about 2~3% of my full plate dataset, GGAGTCTGACATGTGTGCGAGTCAACGGGTGAGTAACCCGCAAGGCACACAGGGATAGG
The latter 19 bp looks to be part of the b adapter but I cannot figure out whether the rest of the sequence is part of the Y-adapter, MID or something else.
Any help or general info on 454 adapters would be very much appreciated.
I.K.
I am finding variants of the following sequence as it's own or at the end of reads in about 2~3% of my full plate dataset, GGAGTCTGACATGTGTGCGAGTCAACGGGTGAGTAACCCGCAAGGCACACAGGGATAGG
The latter 19 bp looks to be part of the b adapter but I cannot figure out whether the rest of the sequence is part of the Y-adapter, MID or something else.
Any help or general info on 454 adapters would be very much appreciated.
I.K.