
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
How to extract multi-mapped reads by samtools? mavishou RNA Sequencing 5 12-05-2016 05:27 AM
Number of Mapped reads ninad Genomic Resequencing 2 08-29-2013 04:15 AM
RNAseq and number of mapped reads seqfan RNA Sequencing 7 06-30-2011 02:01 PM
GAII low number of mapped reads aligenie Bioinformatics 3 06-21-2011 11:55 PM
different number of reads mapped to plus strand and minus strand gfmgfm Bioinformatics 2 02-03-2011 10:26 AM

Thread Tools
Old 12-22-2011, 11:39 AM   #1
Location: Adelaide, Australia

Join Date: Mar 2010
Posts: 12
Default Calculate number of multi-mapped reads?

Hi, does anyone know how to calculate the number of multi-mapped reads from your bam file?

This seems like an obvious/silly question but the latest versions of Cufflinks no longer provides this statistic in the basic output and I have been looking everywhere (log files, samtools stats, this website, etc) but can't figure out how to find this out!

KAP is offline   Reply With Quote
Old 12-22-2011, 12:38 PM   #2
Senior Member
Location: US

Join Date: Jan 2009
Posts: 392

Although primarily to tally up read counts for genes, HT-seq count also adds up the multimap reads "alignment not unique."
chadn737 is offline   Reply With Quote
Old 12-23-2011, 09:19 AM   #3
Location: Adelaide, Australia

Join Date: Mar 2010
Posts: 12

Thanks! I'll look into it.
KAP is offline   Reply With Quote
Old 12-27-2011, 10:31 AM   #4
Location: New York, NY

Join Date: Dec 2010
Posts: 25

Something like this might work.

samtools view -F 4 file.bam | awk '{printf $1"\n"}' | sort | uniq -d | wc -l

samtools view -F 4 file.bam
    print all lines in SAM format except those flagged as unmapped

awk '{printf $1"\n"}'
    print the first field in the line (the read name)

sort | uniq -d | wc -l
    sort the read names
    print only the duplicates (i.e. those appearing more than once)
    count the lines
polyatail is offline   Reply With Quote
Old 12-27-2011, 02:38 PM   #5
Location: Adelaide, Australia

Join Date: Mar 2010
Posts: 12

Thanks, great idea and thanks for the detailed, explanation! I'll give it a try
KAP is offline   Reply With Quote
Old 02-16-2017, 11:04 AM   #6
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default Retrieve mapped reads to certain regions (eg. between 120-140 in a gene)?

I have my own unannotated reference data base. With it, the reads were mapped with Bowtie, now I need to retrieve all reads which mapped to certain region between 120-140 nt/each gene, how can I do it with samtools ? Thanks in advance.
Johnwang is offline   Reply With Quote
Old 02-16-2017, 12:30 PM   #7
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,465

Make a BED file with the gene locations, flank that with bedtools (or awk), and then use it with the "-L" option to "samtools view".
dpryan is offline   Reply With Quote
Old 02-16-2017, 12:33 PM   #8
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default more specifics

Would you please give me more details ? Thanks.
Johnwang is offline   Reply With Quote
Old 02-16-2017, 12:39 PM   #9
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,465

Which part in particular requires more detail?
dpryan is offline   Reply With Quote
Old 02-16-2017, 12:46 PM   #10
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default example


I want to retrieve reads aligned to [GATCGAAAATCTTAATCCCG] within gene above.
Johnwang is offline   Reply With Quote
Old 02-16-2017, 01:21 PM   #11
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,465

If you aligned to the gene itself, then "samtools view alignments.bam Sg01_138835_A_G:120-140". If you aligned to the genome then find out where in the genome that is.
dpryan is offline   Reply With Quote
Old 02-16-2017, 01:46 PM   #12
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Smile how about multiple genes in reference


If I want retrieve reads mapped to same region on multiple (several thousands) genes, do I need to list all, like this, Sg01_138835_A_G:120-140, Sg01_281790_T_C:120-140 ... ?
Johnwang is offline   Reply With Quote
Old 02-16-2017, 11:01 PM   #13
Devon Ryan
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,465

Make a BED file of the regions and use that with the "-L" option.
dpryan is offline   Reply With Quote
Old 02-17-2017, 06:07 AM   #14
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default thanks.

I will do that.
Johnwang is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 02:33 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO