SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Illumina Adapter and Primer preparation S.Iyengar Sample Prep / Library Generation 8 05-30-2019 12:54 PM
trim adapter from Illumina Genome Analyzer IIe miRNA reads NicoBxl Bioinformatics 5 01-02-2014 06:31 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-04-2010 12:28 AM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 06:57 PM

Reply
 
Thread Tools
Old 11-07-2013, 06:55 AM   #121
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Quote:
Originally Posted by bssharma View Post
Hi, I think i got my answer, thanks. If you can also tell me in Illumina sequencing which sequencing read length format generates overlapping end? and how long is the overlapping region for 230bp insert?
Thank you so much
I am sure you can do the calculation yourself.

--
Phillip
pmiguel is offline   Reply With Quote
Old 11-07-2013, 07:06 AM   #122
bssharma
Junior Member
 
Location: Taipei

Join Date: Nov 2013
Posts: 4
Default

Quote:
Originally Posted by pmiguel View Post
I am sure you can do the calculation yourself.

--
Phillip
According to my calculation there will not be any overlapping. Plz correct me if i am wrong.
Thanks!
bssharma is offline   Reply With Quote
Old 11-07-2013, 10:53 AM   #123
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Quote:
Originally Posted by bssharma View Post
According to my calculation there will not be any overlapping. Plz correct me if i am wrong.
Thanks!
That would depend on the length of the reads.

--
Phillip
pmiguel is offline   Reply With Quote
Old 11-26-2013, 07:14 PM   #124
jngao1204
Junior Member
 
Location: shanghai

Join Date: Sep 2013
Posts: 1
Default

Thanks for sharing!
jngao1204 is offline   Reply With Quote
Old 02-17-2014, 06:41 AM   #125
shirley971002
Junior Member
 
Location: china

Join Date: Jan 2014
Posts: 1
Default PCR primers sequences?

Quote:
Originally Posted by protist View Post
The original adapters (what I called legacy) released by Illumina are not exactly the same sequence as the currently in use TruSeq adapters - e.g. old adapters did not have indexes TruSeq ones do. The sequences for the individual TruSeq adapters can be found in the Illumina customer letter (see attached) which can also be downloaded from the Illumina website. I have also attached an alignment I had illustrating the differences between the original adapters and the currently in use TruSeq adapters.
sorry,I am new.I want to know, in Truseq vs old adapters.pdf, which are PCR primers? Can you give the specific sequences? Thank you !
shirley971002 is offline   Reply With Quote
Old 04-24-2014, 05:54 AM   #126
ramkrissh
Junior Member
 
Location: India

Join Date: Apr 2014
Posts: 1
Default

Can any body has details of illumina miseq sequencing for 16S amplicon library construction specific to V3 region only . I need primer , adapter and barcode sequences used for V3 region 16S sequencing ..... Please help
ramkrissh is offline   Reply With Quote
Old 05-23-2014, 01:16 AM   #127
Katerina Cvikova
Junior Member
 
Location: Olomouc

Join Date: Apr 2014
Posts: 6
Default

Hi everybody,
do you know if it is possible to sequence in one run on MiSeq libraries from Nextera DNA and TruSeq PCR-Free together?
Katerina Cvikova is offline   Reply With Quote
Old 05-23-2014, 03:27 AM   #128
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,238
Default

Yes. They are perfect match if prepared by standard method. Both would have relatively similar peak size, so preferential clustering of smaller fragments will not be an issue and you can expect to get reads from both in proportion to input library.
nucacidhunter is offline   Reply With Quote
Old 09-29-2014, 09:25 AM   #129
Sarutis
Junior Member
 
Location: NM

Join Date: Feb 2010
Posts: 6
Default 2x300 MiSeq amplicon libraries barcoded primers

I'm new to MiSeq sequencing and to this blog and I'm having difficulties:

I'm sure these info are somewhere in the blog, but would someone be so kind and tell me where to find the primer design info for barcoded amplicon library for a 2x300 MiSeq run?
Are there any other info needed
Thanks in advance
Sarutis is offline   Reply With Quote
Old 09-29-2014, 10:29 AM   #130
relipmoc
Member
 
Location: Los Angeles, CA

Join Date: Jul 2011
Posts: 58
Default Skewer supports demultiplexing amplicon pairs

Quote:
Originally Posted by Sarutis View Post
I'm new to MiSeq sequencing and to this blog and I'm having difficulties:

I'm sure these info are somewhere in the blog, but would someone be so kind and tell me where to find the primer design info for barcoded amplicon library for a 2x300 MiSeq run?
Are there any other info needed
Thanks in advance
Recently we indexed 6 amplicon libraries and sequenced them in a 2 x 300bp MiSeq run. Each of these 6 amplicon libraries was also a mixed library which contains about 60 samples barcoded by different combination of forward-primer sequence and reverse-primer sequence (In fact, fragments from these samples were also ligated with 6 nucleotides index sequences). Hence we may demultiplex about 360 samples using this protocol.

In my understanding, the first level barcoding is easy to handle, you should note down the 6 bp index sequences when construct the libraries, and later you can specify the 6 bp sequences in the Sample Sheet when preparing a MiSeq run. For the second level barcoding, you need to know what gene region is amplified with what primers (forward and reverse).

For demultiplexing, I suggest you use skewer (http://sourceforge.net/projects/skewer/) which supports demultiplexing amplicon pairs.

Last edited by relipmoc; 09-29-2014 at 10:31 AM. Reason: title
relipmoc is offline   Reply With Quote
Old 09-29-2014, 10:37 AM   #131
Sarutis
Junior Member
 
Location: NM

Join Date: Feb 2010
Posts: 6
Default

Thanks, relipmoc
Since you were so kind to answer quickly, I'll ask few more things:
what do you use to connect overlapping paired sequences? I found PEAR and stitch as avaliable softwares, but I'd like an expert opinion
Sarutis is offline   Reply With Quote
Old 11-17-2014, 07:18 PM   #132
ssully
Member
 
Location: NYC

Join Date: Aug 2010
Posts: 48
Default

I'm quite lost. I've got a set of paired end 100 nt HiSeq reads (library insert size was ~300bp) from a colleague and I can't determine what adapter sequences to trim. The current Illumina letter to customers lists a variety of sequences. Can someone explain the use of this set

Quote:
Oligonucleotide sequences for Paired End DNA

PE Adapters
5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PE Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
versus this set?
Quote:
Oligonucleotide sequences for the Multiplexing Sample Prep Oligo Only Kit
Multiplexing Adapters
5' P-GATCGGAAGAGCACACGTCT
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing PCR Primer 2.0
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Multiplexing Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Multiplexing Index Read Sequencing Primer
5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Multiplexing Read 2 Sequencing Primer
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
PCR Primer, Index 1
5’ CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTC
PCR Primer, Index 2
5’ CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC
.
.
.etc for 12 indexes total..

For a paired end set that includes indices (barcodes) which set would have been used?


Also, what are the 2 sequences of the oligos that coat a paired end flowcell used in the current HiSeq platform? (these would be sequences complementary to adapters sequences)

Last edited by ssully; 11-17-2014 at 07:22 PM.
ssully is offline   Reply With Quote
Old 11-18-2014, 01:47 PM   #133
ssully
Member
 
Location: NYC

Join Date: Aug 2010
Posts: 48
Default

Illumina helped sort me out. The seqs I posted last time are from an old , discontinued version of the kit (pp 20-21 of the July 2014 letter). The newer TruSeq adapters('universal' and 'indexed') are found on pp 12-13 of the letter .

These 'floppy end' adapters dimerize only at their last 12 nt. After they're ligated to flanks of the insert DNA fragment the result looks like this:
Code:
universal                                                                                                                indexed
5'             AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTTCCGATCT---insert--AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3'
                                                                |||||||||||||||||||||||||||||||||||||                          
3'     GTTCGTCTTCTGCCGTATGCTCTNNNNNNAGCACTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGA---insert--TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA  5'
indexed                                                                                                                  universal
If there is a PCR enrichment step (which is omitted from the new PCR-free kits) the PCR primers are

P1: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA
(i.e. the first 44 bases of the universal adapter)

P2: 5' CAAGCAGAAGACGGCATACGAGAT
(reverse complement of the last 24 bases of the indexed primer)

P2 primes first, and then the ssDNA from P2 priming/extension becomes the template for P1. So the PCR product is:

Code:
5'AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTTCCGATCT---insert-----AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3'
3'TTACTATGCCGCTGGTGGCTCTAGATGTGTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA---insert-----TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNTAGAGCATACGGCAGAAGACGAAC 5'

The enriched PCR product can then be denatured and each strand hydbridized to the bound flowcell oligos for cluster generation and reading.

Last edited by ssully; 11-18-2014 at 01:57 PM.
ssully is offline   Reply With Quote
Old 11-28-2014, 12:05 PM   #134
ksil91
Junior Member
 
Location: Chicago, IL

Join Date: Nov 2014
Posts: 2
Default Indexed PCR Primer Ordering

Hello, I'm new here so apologies if this question has been answered.

I'm following the Buckler Lab GBS protocol and only have access to 48 adapters for ApeKI. I'd like to multiplex these into one Illumina lane using indexed PCR primers. I found sequences for PCR primers from the ddRAD protocol(Peterson). Do I have to alter the sequence at all to match my ApeKI adapters? Do I have to request anything particular when ordering these primers from IDT? Or would it be better for me to just order the NEBNext Multiplex Oligos for Illumina Kit? (https://www.neb.com/products/e7335-n...-primers-set-1)

ApeKI Common Adapter:
5'-CWGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5'-CTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

ApeKI Barcoded Adapter:
5-CWGxxxxAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
5-ACACTCTTTCCCTACACGACGCTCTTCCGATCTyyyy

PCR primers I'm considering ordering:
PCR1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG
PCR2_Idx_1_ATCACG: CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_2_CGATGT: CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_3_TTAGGC: CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGC
PCR2_Idx_4_TGACCA: CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGC
ksil91 is offline   Reply With Quote
Old 01-19-2015, 12:50 PM   #135
Ingeneious
Member
 
Location: Los Angeles, CA

Join Date: Dec 2014
Posts: 30
Default

Quote:
Originally Posted by ssully View Post
Illumina helped sort me out. The seqs I posted last time are from an old , discontinued version of the kit (pp 20-21 of the July 2014 letter). The newer TruSeq adapters('universal' and 'indexed') are found on pp 12-13 of the letter .

These 'floppy end' adapters dimerize only at their last 12 nt. After they're ligated to flanks of the insert DNA fragment the result looks like this:
Code:
universal                                                                                                                indexed
5'             AATGATACGGCGACCACCGAGATCTACACACACTCTTTCCCTACACGACGCTCTTCCGATCT---insert--AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG 3'
                                                                |||||||||||||||||||||||||||||||||||||                          
3'     GTTCGTCTTCTGCCGTATGCTCTAGNNNNNNCACTACACTGACCTCAAGTCTGCACACGAGAAGGCTAGA---insert--TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA  5'
indexed                                                                                                                  universal
I think your index in the 3' to 5' read was off for so I adjusted it. Based on the 07-14 Illumina Customer letter for TruSeq HT indexes, the dual index would look something like this?
Code:
5' AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATC-T-insert-A-GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG 3'
			      	                      |||||||||||||||||||||||||||||||||||
3'     GTTCGTCTTCTGCCGTATGCTCTA[i7]CACTGACCTCAAGTCTGCACACGAGAAGGCTAG-A-insert-T-CTAGCCTTCTCGCAGCACATCCCTTTCTCACA[i5]CACATCTAGAGCCACCAGCGGCATAGTAA 5'
Ingeneious is offline   Reply With Quote
Old 07-01-2015, 10:12 AM   #136
clueheart
Junior Member
 
Location: hun

Join Date: Feb 2015
Posts: 3
Default

Hi,

i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.

To my understanding it should be HP11.

Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?
clueheart is offline   Reply With Quote
Old 07-01-2015, 11:40 AM   #137
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,317
Default

Quote:
Originally Posted by clueheart View Post
Hi,

i am uncertain what is the actual sequence of the read2 primer on Hiseq, PE amplicon sequencing.

To my understanding it should be HP11.

Is ATCTCGTATGCCGTCTTCTGCTTG the correct sequence for HP11 ?
To the best of my knowledge Illumina never shares the sequences of their primers. Adapters, yes. Primers, no.

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-23-2015, 10:33 AM   #138
enum
Junior Member
 
Location: usa

Join Date: Jul 2015
Posts: 2
Default

Hi,

I'm following the protocol from this TCR sequencing paper: http://www.nature.com/nbt/journal/v3.../nbt.2938.html

The PE primers they used are:
PEprimerl AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PEprimer2 AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Should I tell sequencing center to use P5 and P7 primers for MiSeq for the PCR product? I can see P5 primer sequence in PEprimer1 but PEprimer2 doesn't have exact P7 sequence. It lacks first "C"? Could anyone help me?

Thank you!
enum is offline   Reply With Quote
Old 08-21-2015, 03:34 AM   #139
troubleble
Junior Member
 
Location: Asia

Join Date: Sep 2011
Posts: 1
Default

(reply to clueheart)

Just wanna remind you:
HP11 combines at least 2 kinds of sequencing primer.
The sequence you posted should be one of them, but I dont know the exact letter too, maybe no one knows except Illumina.
btw, the other primer should fit NextEra system.
troubleble is offline   Reply With Quote
Old 09-22-2015, 04:18 PM   #140
ajthomas
Senior Member
 
Location: Utah

Join Date: Mar 2010
Posts: 166
Default

Quote:
Originally Posted by ssully View Post
I'm quite lost. I've got a set of paired end 100 nt HiSeq reads (library insert size was ~300bp) from a colleague and I can't determine what adapter sequences to trim. The current Illumina letter to customers lists a variety of sequences. Can someone explain the use of this set



versus this set?



For a paired end set that includes indices (barcodes) which set would have been used?


Also, what are the 2 sequences of the oligos that coat a paired end flowcell used in the current HiSeq platform? (these would be sequences complementary to adapters sequences)
I've been trying to sort this out to order some primers to use for making amplicon libraries on the Fluidigm Access Array. The Fluidigm protocol uses non-standard sequences (and therefore custom sequencing primers), and is not compatible with PE sequencing. I want to modify it to use standard Illumina sequences so that the libraries are PE compatible and fit better into the Illumina ecosystem.

The confusion comes from these adapter sequences:
Quote:
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

Multiplexing PCR Primer 2.0
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
Multiplexing Read 2 Sequencing Primer
5' GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
The sequence of the adapter used to attach the i7 adapter (and index) is different. Either one should work to make a library, but the problem will come when sequencing read 2 and reading the first index. A different sequencing adapter will be needed. Which is the correct sequence?
ajthomas is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:49 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO