Hi,
according to the name conventions in miRBase, closely realted-but not similar- mature miRNAs should be named like miR-121a and miR-121b.
" Lettered suffixes denote closely related mature sequences "
Why does this not hold true for plant miRNAs?
I work with medicago and for medicago there are a bunch of mature miRNAs with the same sequence.. For example:
>mtr-miR2593a MIMAT0013280 Medicago truncatula miR2593a
TTAAATGAATGAACCTAGAAT
>mtr-miR2593b MIMAT0013281 Medicago truncatula miR2593b
TTAAATGAATGAACCTAGAAT
>mtr-miR2593c MIMAT0013282 Medicago truncatula miR2593c
TTAAATGAATGAACCTAGAAT
They have different PRECURSOR sequences but the mature sequence is completely the same. Does this make any sense at all? If you perform an experiment like sRNA-Seq you will only see the mature form and wont be able to identify the precurosr it was derived from anyway.
Do you have any idea why people from miRBase do not stick to their own rules here?
Cheers
according to the name conventions in miRBase, closely realted-but not similar- mature miRNAs should be named like miR-121a and miR-121b.
" Lettered suffixes denote closely related mature sequences "
Why does this not hold true for plant miRNAs?
I work with medicago and for medicago there are a bunch of mature miRNAs with the same sequence.. For example:
>mtr-miR2593a MIMAT0013280 Medicago truncatula miR2593a
TTAAATGAATGAACCTAGAAT
>mtr-miR2593b MIMAT0013281 Medicago truncatula miR2593b
TTAAATGAATGAACCTAGAAT
>mtr-miR2593c MIMAT0013282 Medicago truncatula miR2593c
TTAAATGAATGAACCTAGAAT
They have different PRECURSOR sequences but the mature sequence is completely the same. Does this make any sense at all? If you perform an experiment like sRNA-Seq you will only see the mature form and wont be able to identify the precurosr it was derived from anyway.
Do you have any idea why people from miRBase do not stick to their own rules here?
Cheers