SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic quality trimming kga1978 Bioinformatics 26 11-24-2015 10:14 AM
Kmers remain even after trimmomatic trimming modi2020 Bioinformatics 17 03-16-2015 04:47 AM
Trimming paired end RNAseq - Trimmomatic sjeschonek Bioinformatics 1 07-14-2014 11:52 AM
Adapters trimming: Cutadapt vs Trimmomatic MafaldaSF Bioinformatics 8 03-20-2014 06:16 AM
Trimming Illumina PE sequences with Trimmomatic nicole_01 Bioinformatics 5 08-28-2013 05:12 PM

Reply
 
Thread Tools
Old 09-26-2015, 11:03 PM   #1
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default Trimmomatic but no trimming

Hii dear friends

I have a question about Trimmomatic. I wrote this command:

java -jar /usr/bin/trimmomatic-0.33.jar PE -phred64 72_L3_1.fq.gz 72_L3_2.fq.gz 71P_1.fq.gz 71UP_1.fq.gz 71P_2.fq.gz 71UP_2.fq.gz ILLUMINACLIP:Over.fasta:2:40:15


72_L3_1.fq.gz
and
72_L3_2.fq.gz
are my input files

71P_1.fq.gz
71UP_1.fq.gz
71P_2.fq.gz
and
71UP_2.fq.gz
are my output files. In my case P means paired and UP means unpaired.

after I did fastqc I got overrepresented sequence (it is not adapter) and I stored it in Over.fasta and I want to trim it from my data.

but when I run the command I see this:

ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
Input Read Pairs: 19759652 Both Surviving: 19759652 (100.00%) Forward Only Surviving: 0 (0.00%) Reverse Only Surviving: 0 (0.00%) Dropped: 0 (0.00%)

It does not trim the sequence.

Why it is like that?

In addition, for Palindrome and Single mode U just selected 40 and 15 because the manual selected them. Actually I do not know which score I should select. How can I choose the correct score?

Would you please help me in these two questions.

-------------------------------------------------------------------
I'm sorry for asking so many questions each day. I' working with RNA-seq data in these days. In each level, I should stop due to errors, warnings, blocks and confusions and this story continues.

and thank you for helping me in solving all these problems.
Saeideh is offline   Reply With Quote
Old 09-27-2015, 07:52 PM   #2
yueluo
Member
 
Location: Guangzhou China

Join Date: Aug 2013
Posts: 82
Default

Are you sure nothing was done the your sequences? 100% reads surviving does not necessarily mean no trimming was performed, especially when you don't specify MINLEN.
yueluo is offline   Reply With Quote
Old 09-27-2015, 08:21 PM   #3
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default

Yes, I'm almost sure because when I do fastqc, the number of reads and nucleotides in them have not changed (I mean "Total sequences" and "Sequence length").
Saeideh is offline   Reply With Quote
Old 09-28-2015, 05:41 AM   #4
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,177
Default

Quote:
Originally Posted by Saeideh View Post
ILLUMINACLIP: Using 0 prefix pairs, 0 forward/reverse sequences, 0 forward only sequences, 0 reverse only sequences
The explanation is here (highlighted in red). Trimmomatic is not finding any valid sequences to use for trimming in the supplied clipping file 'Over.fasta' meaning you must have formatted it incorrectly.
kmcarr is offline   Reply With Quote
Old 09-28-2015, 09:12 PM   #5
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default

I put following sequences in Over.fasta

CTCCCATTTCGCTCGCCGCTACTACGGGAATCGCTTTTGCTTTCTTTTCC
GGCTTGCGGTGGATACCTAGGTACCCAGAGACGAGGAAGGGCGTAGCAAG

Isn't it correct?
Saeideh is offline   Reply With Quote
Old 09-28-2015, 11:11 PM   #6
yueluo
Member
 
Location: Guangzhou China

Join Date: Aug 2013
Posts: 82
Default

That is not a valid fasta file.

https://en.wikipedia.org/wiki/FASTA_format
yueluo is offline   Reply With Quote
Old 09-28-2015, 11:40 PM   #7
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default

Alriiiiiight...

I got it

Thanks all
Saeideh is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:32 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO