SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
RepeatMasker & RepeatScout Zimbobo Bioinformatics 40 04-29-2019 01:20 PM
RepeatScout anna_sh Bioinformatics 2 05-06-2011 07:38 AM

Reply
 
Thread Tools
Old 01-05-2012, 09:06 PM   #1
heiya
Member
 
Location: China

Join Date: Nov 2011
Posts: 14
Default problem with RepeatScout

Hello,

I run RepeatScout to uncover novel repeats according to the manual. However I didn't know what does the result of repeats.fa as follow mean?
>R=0
TTGTAATCGATTTTACTCTCTGGTAATCGATTACCAGAGAGTAGTAATCGATTACAA

what does R refer to?

another question is why the finally repeats.fa.filter used the command filter-stage-1.prl empty? all the reply is grateful!
heiya is offline   Reply With Quote
Old 01-09-2012, 11:51 PM   #2
gprakhar
Member
 
Location: India

Join Date: Aug 2010
Posts: 78
Default

Hi,

You could look at,
http://openwetware.org/wiki/Wikiomic...ng#RepeatScout
For analysis.

or

Alternatively I would recommend use Repeat-Modeler to generate a denovo/novel repeat library and use it with Repeat Masker to analyze your genome.
Repeat Modeler uses repeat scout and some other programs internally, hence it saves you the hassle and the results are very well organized and annotated.

--
pg
gprakhar is offline   Reply With Quote
Old 01-09-2012, 11:57 PM   #3
heiya
Member
 
Location: China

Join Date: Nov 2011
Posts: 14
Default

thanks,gprakhar!

I'll try as you say!
heiya is offline   Reply With Quote
Old 10-02-2012, 10:44 AM   #4
sunhh
Member
 
Location: Ithaca, NY

Join Date: Jun 2012
Posts: 18
Default

Quote:
Originally Posted by gprakhar View Post
Hi,

You could look at,
http://openwetware.org/wiki/Wikiomic...ng#RepeatScout
For analysis.

or

Alternatively I would recommend use Repeat-Modeler to generate a denovo/novel repeat library and use it with Repeat Masker to analyze your genome.
Repeat Modeler uses repeat scout and some other programs internally, hence it saves you the hassle and the results are very well organized and annotated.

--
pg
Hi gprakhar,
Could you tell me how long time RepeatModeler will take to de novo annotate a soybean genome (~973Mb)? It took me over a week now, and I can not see the end.

Thanks!
sunhh is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:40 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO