SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
why can not download Abyss 1.3.2 elisadouzi Bioinformatics 0 12-13-2011 08:22 PM
Working Of Abyss aarifjindani Bioinformatics 0 11-06-2011 09:05 PM
Abyss-PE error joa_ds Bioinformatics 1 11-30-2010 08:32 PM
python in ABySS dror RNA Sequencing 0 11-28-2010 05:19 AM
documentation for ABySS harrb Bioinformatics 1 11-23-2010 08:18 AM

Reply
 
Thread Tools
Old 04-04-2011, 02:13 AM   #21
Seta
Member
 
Location: Europe

Join Date: Mar 2011
Posts: 14
Default

That is weird!!! the last time I tried it din't work and now it is reading the file! I'll cross my fingers and hope for the best. Do you have any idea how long it could take? I read somewhere that it can take between 3 and 10 hours...
Seta is offline   Reply With Quote
Old 04-04-2011, 02:31 AM   #22
ffinkernagel
Senior Member
 
Location: Marburg, Germany

Join Date: Oct 2009
Posts: 110
Default

that depends.
What exactly are you trying to assemble, how many reads do you have, etc?.

Generally, assembly can take a long (long) time.
ffinkernagel is offline   Reply With Quote
Old 06-09-2011, 07:29 AM   #23
Dorisday81
Junior Member
 
Location: Poland and Germany

Join Date: Jun 2011
Posts: 1
Default

Hi all, I'm new here and have a problem.
Maybe its not right place to write but I can not write new post.

I'm using the ABySS for 36bp sequences and now will use the trans-ABySS.

I used command: for k in {18..35}; do ABYSS <file to analyze> -o <where save the file>-k@$k.fa;

My input was file with contigs (after format: fastanrdb) with FASTA extenstion.

I got from ABYSS analysis files. They looks like (examples):

>0 31 117
AGACTTCCCAACATTTATTGCTCTTTCTCTT
>1 35 79
ATGAATTCTATTGGAGATTGTACATTAGTTATGTA
>2 27 60
ATGAATTCTATTGGAGAATGTACATTA
>3 44 666
TTTTTATTTTTGTTCAGAAGGAGTCGTTGGTTGTTCTTCATTTT
>4 111 1332
GATGGTGTAATGAACTCAACAATATCATCTCTTATTACTATATCTGACCGTGCTTATGTAACATTAACTAATTACCAAGGATTGTATAGATTAAATTGTGACCAGAAAACT
>5 18 31
GGAGTGTCGATGCTTGAA
>6 38 213
GCAAATTCTGTTACAATTGATATTTCTCCTTCTGTATA


I have problem with next step of analysis-the trans-Abyss

In manual guide I read that the trans abyss needs specific folder structure.

I dont know what does it means, because I put my results from abyss (in fasta) in folders: LIB0001/kn(15-35)/...fasta (from abyss)

I dont know what is next?

sorry for so complicates question but I am so sad sitting, reading and nothing.....
Dorisday81 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:29 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO