SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
not uniquely mapped reads unidodo RNA Sequencing 2 04-22-2011 02:07 PM
ID'ing Uniquely Mapped Regions in BWA Protaeus Bioinformatics 2 12-10-2010 02:31 AM
Uniquely mapped reads with bowtie mapper Bioinformatics 2 11-22-2010 10:44 PM
DEGseq and uniquely mapped reads PFS Bioinformatics 1 07-14-2010 09:37 AM
cufflinks and non-uniquely mapped reads clariet Bioinformatics 1 05-08-2010 11:13 AM

Reply
 
Thread Tools
Old 09-06-2010, 03:32 AM   #1
NF_seq
Junior Member
 
Location: Beijing, China

Join Date: Jun 2010
Posts: 2
Default BWA Uniquely Mapped Reads

Hello, everyone!
This is an alignment output I got from "bwa sampe", and as I know, "XT:A:U" means "reads uniquely mapped to reference", but I also got the alternative hits of "XA:...", why is that?? And if I only care about uniquely mapped reads, is this kind of reads what I want? Please help me out, Thanks A Lot!

d5_lpEsQulsn42 147 chr4 110995170 60 63M = 110995022 -211 TTTCTTTTGCCTGATTGCCCTGGCCAGAGCTTCCAATACTGTGTTGAATAGGAGTGGTGAGAG __aYbaaa_c_bbabWaa`_\bbbbabb`bbbbbbbbbabbbbbbbbbbbbbbbbbbbbbbbb XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:1 XM:i:0 XO:i:0 XG:i:0 MD:Z:63 XA:Z:chr11,-121159338,63M,1;

Last edited by NF_seq; 09-06-2010 at 03:38 AM.
NF_seq is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:34 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO