
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
badly sorted BAM Filippo Bioinformatics 3 12-29-2011 12:39 PM
How to get all contig boundaries from a sorted bam file dustar1986 Bioinformatics 3 09-30-2011 12:31 AM
how to check whether a bam fille is sorted using picard in java jay2008 Bioinformatics 0 05-23-2011 03:14 PM
Sorted bam wangzkai Bioinformatics 3 05-07-2010 01:37 AM

Thread Tools
Old 05-25-2012, 07:58 AM   #1
Location: St. Louis, MO

Join Date: Aug 2011
Posts: 53
Default sorted bam larger than unsorted bam

Recently i've sorted 2 different alignments and in both cases the sorted bam is ~3x larger in disk size. I did the sort twice with the same result.
Does anyone have a suspicion of what is going on here?
ians is offline   Reply With Quote
Old 05-26-2012, 09:05 AM   #2
Senior Member
Location: Oxford

Join Date: Feb 2012
Posts: 129

1, output bam uncompressed? (show the command line pls.)
2, you are sorting on name or coord? could it be that bgzip block can't compress that hard after the sort? (Very unlikely though.)
xied75 is offline   Reply With Quote
Old 05-29-2012, 07:06 AM   #3
Location: St. Louis, MO

Join Date: Aug 2011
Posts: 53

Here's what i'm running:

time -v samtools sort $mergedBam $sortedBam
Another run yielded the same result.
ians is offline   Reply With Quote
Old 05-30-2012, 05:02 AM   #4
Senior Member
Location: Cambridge, UK

Join Date: Jul 2008
Posts: 146

Do you have a combination of shallow coverage and excessively long read names? That can cause the sorting to be of little benefit to sequence and positional compression while also being detrimental to read name compression.
jkbonfield is offline   Reply With Quote
Old 05-30-2012, 05:51 AM   #5
Location: St. Louis, MO

Join Date: Aug 2011
Posts: 53

headers aren't anything out of the ordinary. Here are a few entries from the sorted bam:

HWI-ST1063_0137:6:1308:10615:65342#0	81	chr1	1019	1	101M	=	765	-354	ATAAATGTCCATAAGTAGACATGAAGCCTGCAGAATTCCAAATAGAATGGACCAGAAAATAAATTCCTCCTGTCACATAATAGTCAAAACACCAAATGCAC	>>;>;5;@;;A;7.))7;7@C=?CA;@DAA=ADC;ECC=DB@IED<DBB?0D99??0499:<9DDC88:2<F9FAFDCA?CCBEE<:C<?DDABDB+??1?	PG:Z:novoalign	AS:i:1UQ:i:14	NM:i:1	MD:Z:14A86	CC:Z:=	CP:i:71209	ZS:Z:R	ZN:i:3	NH:i:3	HI:i:1	IH:i:3
This is an RNAseq project and we have sufficient number of reads to get a deep sampling. I suspect something is going wrong at this step because down stream I am getting 20% coverage over the genome with this sample...

I aligned using novoalign, if that is of any consequence.
ians is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 12:49 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO