SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Cufflink running error: Processed 0 loci NGS2009 RNA Sequencing 0 01-28-2012 06:53 AM
BWA and Solid data issue ulz_peter Bioinformatics 8 08-11-2011 02:32 AM
Does bwa support SOLiD PE data? 2007lab Bioinformatics 0 05-09-2011 11:33 AM
BWA and Illumina data/results Papillon Bioinformatics 6 04-13-2011 07:09 AM
Recommended BWA parameters for SOLiD data ... akundaje Bioinformatics 0 05-19-2010 10:26 PM

Reply
 
Thread Tools
Old 03-25-2010, 03:02 AM   #1
mingkunli
Member
 
Location: Germany

Join Date: Jan 2009
Posts: 41
Default PE data processed by bwa

I am processing the PE solexa data using BWA, I met a problem after I looked through the sampe result.

Although I set the -a(maximum insert size) to be 300, I still found lots of PE mapped with the insertion > 300bp, some even around 5000bp. When I do the pileup, if these PE reads would be taken into consideration ?
or I should remove these reads manually?

At the same time, there are also some reads mapped without mate, they are still in the sampe file, will they be taken into account when I do the pileup ?

All in all, will all the mapped reads(even not in pair or have anomalous insertion distance) in the sampe will be used in the pileup?
mingkunli is offline   Reply With Quote
Old 03-25-2010, 05:07 AM   #2
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

You should check FLAG 0x2 (see sam spec), not just looking at ISIZE. Anomalous pairs will used by pileup by default. But you can throw them away by:

samtools view -uf2 aln.bam|samtools pileup -
lh3 is offline   Reply With Quote
Old 03-26-2010, 07:09 AM   #3
mingkunli
Member
 
Location: Germany

Join Date: Jan 2009
Posts: 41
Default

Thanks, lh3.

if I want to use -F to filter out two Flags, or -f to keep two Flags, should I use -F 48, otherwise, I can run -F 4, and -F 8 separately.

I met the flag 87 with my pair-end data like I show below. I think it maybe due to two possibilities:
1, software bug.
2, The match was detected by Smith-Waterman for the unmapped mate.

No matter which is true, it would cause some problem with other softwares,for example, when i use Tablet to visualize the mapping, the flag will crash the loading.

SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 87 human_L19 4890 60 76M = 4765 -201 GCCTCCCACCCAAAATGAGTTCCTGCTCTTCCTCCTTGCCCCTCAGCCCTAGTCATTTCCTCATTTGCAGTTCCCC /14414:4494738:<6968>9?<8=;A=>:?>??:=9;96==?;;:<>>=<=<<<>;:A;=>;:=9<98976363 XT:A:U NM:i:2 SM:i:37 AM:i:23 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:10A64T0
SOLEXA-GA05_PEi_JG_SP_KG_DQ_QF:5:79:9492:4342#GCTCCAA 163 human_L19 4765 60 76M = 4890 201 CTGTATTTGCATTTGCTGTCTTGCTGGTCTCAAGATTCCCAAGCGCTGCTGCCAGCCCACCCCTTCAGCCTGCCAA 3186><:;::=:9@?;:<9;:7:96<;=<9>A<;><8:=7;;><:99977:66<95:58847421110/202/02- XT:A:U NM:i:0 SM:i:23 AM:i:23 X0:i:1 X1:i:2 XM:i:0 XO:i:0 XG:i:0 MD:Z:76 XA:Z:human_L19,+4765,75M1S,4;human_L19,+4765,76M,5;
mingkunli is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO