SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to get uniquely mapped reads from Tophat subeet Bioinformatics 10 11-28-2012 05:56 AM
paired-end reads mapped to genome.. gene with only one direction of paired-end reads? danwiththeplan Bioinformatics 2 09-22-2011 02:06 AM
Paired-end reads mapping to different chromosomes... rareaquaticbadger Bioinformatics 1 06-27-2011 04:24 AM
Paired-end reads mapped 50% while each pair reads mapped 80% zack80.liu Bioinformatics 3 03-03-2011 01:06 AM
Exon-Junction mapping: re-assigning CDS-mapped reads to chromosomes sridharacharya RNA Sequencing 1 10-21-2010 04:07 PM

Reply
 
Thread Tools
Old 04-09-2010, 08:50 AM   #1
wenhuang
Member
 
Location: Raleigh, NC

Join Date: Feb 2010
Posts: 30
Default tophat paired reads mapped to different chromosomes

Hi,

I noticed that tophat some times can map paired end reads to different chromosomes (see one example below). The sequences are undoubtedly of low complexity.

I haven't looked to see how often this may happen (I guess rarely), but I wanted to ask if there is an option to control this behavior in tophat?

Thanks!


HWUSI-EAS787_0001:5:31:1709:802#TTTTTT 113 chr1 23 255 81M 62678829 0 AGATCAACTAAACAGAAAATTAACAAGGAAAAAAAAACAAAACAAAACATGTATCTATAAAGCTCACTAAAGCAAAGCACA GGHEHHHE@HHHGHHHHHHHHHHHHHECGGGGGGGGHGGGGHHHHHHHHHHHHHHHHHHHHHHFHHHHHHHHHHHDFFGGG NM:i:2
HWUSI-EAS787_0001:5:31:1709:802#TTTTTT 177 chr12 62678829 255 81M = 23 0 CTTTATAGATACATTTTTTGTTTTGTTTTTTTTTCCTTGTTAATTTTCTGTTTAGTTGATCTATCCATAAGTGTGAGTGGG #ECG@D9./9-@'7+:BCH,CCCB.CEEHHHHHDHDCG:GCE:HHHHFH5HGEB?GAAH9DHHHHHHHFHHHHHHHGHFHG NM:i:1
wenhuang is offline   Reply With Quote
Old 04-10-2010, 06:54 AM   #2
choy
Member
 
Location: Michigan

Join Date: Jul 2009
Posts: 14
Default

Hi there -- I have noticed this behavior as well. To handle it, I filtered out the reads from the SAM file using SAMtools and pysam. I have notified Cole Trapnell about this behavior -- perhaps it will be corrected in a future version.

Cheers,
Matthew
choy is offline   Reply With Quote
Old 04-10-2010, 08:22 AM   #3
wenhuang
Member
 
Location: Raleigh, NC

Join Date: Feb 2010
Posts: 30
Default

I found out that there were not many cases like this.

I ended up filtering based on the bitwise flag in the second column of the SAM file simply using awk. Paired end reads mapping to different chromosomes falls in one of the flags that have improper mapped pairs. In addition to mapping to different chromosomes, there are cases where paired end reads are on the same strand, etc. This filtered out less than 10% of the aligned reads. I feel that these reads might be useful in looking for structural changes, but being able to control it is definitely good.
wenhuang is offline   Reply With Quote
Old 06-23-2010, 05:23 AM   #4
snp_analyser
Junior Member
 
Location: Philadelphia

Join Date: Jun 2010
Posts: 4
Question still having the problem...

I filtered out alignments got from TOPHAT using bit 1 and 2 of the SAM flag (column 2), but am still encountering pairs mapped to different chromosomes. Any other way around this problem without actually checking for column 3?

Sample Output:

7_IR4IbRc7842 147 chr1 6917 255 75M = 7043 0 ACCTGCAAGATTAGGCAGGGACATGTGAGAGGTGACAGGGACCTGCAGGGGCAGCCAACAAGACCTTGTGTGCAC PQQQTNSOPPPTNTUQJR[QLPPPXNQKQNTTSTPTPZ^ZS\YTSTU^baa``baaaaaaab^abbbbbbbbaaa NM:i:0


7_IR4IbRc7842 99 chr9 7043 255 75M = 6917 0 CGGGGCCCAGGTCGGCAATGTACATGAGGTCGTTGGCAATGCCGGGCAGGTCAGGCAGGTAGGATGGAAAATGGA aaaaaaaaaaa\aaaaaaaa^aaa`a```Z^_RZ``^]^]]\][Y`[\^[JXV]XSPR]KP\BBBBBBBBBBBBB NM:i:2


By the way the sam flags translate to:
99=1100011
147=10010011

Last edited by snp_analyser; 06-24-2010 at 01:35 PM. Reason: UPDATE
snp_analyser is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:57 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO