SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
trim adapter from Illumina Genome Analyzer IIe miRNA reads NicoBxl Bioinformatics 5 01-02-2014 06:31 AM
Illumina Adapter and Primer preparation S.Iyengar Sample Prep / Library Generation 7 11-04-2013 08:08 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-04-2010 12:28 AM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 06:57 PM

Reply
 
Thread Tools
Old 05-31-2010, 11:11 PM   #61
nanos
Member
 
Location: Vienna

Join Date: May 2010
Posts: 11
Default

hi!!

i would like to use custom adaptors to do ChiP sequencing.

for this i would need to know what the concentration of the adaptor for this protocol is.

thanks for your help
nanos is offline   Reply With Quote
Old 07-19-2010, 07:22 AM   #62
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Quick FYI. I spent many hours trying to get the PCR amplification working with Sigma primers (with the phosphorothioate bond), but with very low yields. After switching to the Illumina-supplied primers, my yield shot up.

What suppliers for primers have people used, where they found the custom primers to work properly?
AdamB is offline   Reply With Quote
Old 07-19-2010, 07:58 AM   #63
kmcarr
Senior Member
 
Location: USA, Midwest

Join Date: May 2008
Posts: 1,135
Default

Quote:
What suppliers for primers have people used, where they found the custom primers to work properly?

IDT

(now some jibberish to meet the 10 character minimum for posting)
kmcarr is offline   Reply With Quote
Old 07-19-2010, 08:31 AM   #64
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

I don't see anyone mentioning the two locked nucleic acid (LNA) bases in the primers. People have told me that this dramatically increases library yields.

http://genomics.med.tufts.edu/docume...ina_paired.pdf
NextGenSeq is offline   Reply With Quote
Old 07-19-2010, 09:41 AM   #65
AdamB
Member
 
Location: uk

Join Date: Apr 2010
Posts: 43
Default

Quote:
Originally Posted by kmcarr View Post

IDT

(now some jibberish to meet the 10 character minimum for posting)
Thanks, and did you have the phosphorothioate bonds at the 3' end?
AdamB is offline   Reply With Quote
Old 08-26-2010, 08:32 AM   #66
clz8782
Guest
 

Posts: n/a
Default

Quote:
Originally Posted by sci_guy View Post
The P.E adaptors/primers have been added at the original link.
I have ordered Illumina's paired end primers and had low yield of PCR amplicons of my library. I was sent supplemental information from this nature paper. http://www.nature.com/nature/journal...re07517-s1.pdf

This states that the PCR primers should have a phosphorothioate bond at the 3' end:

5-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC
TCTTCCGATCxT and 5-
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT
CCGATCxT (x = phosphorothioate bond resistant to excision by 3-5 exonucleases).

This is the first I am hearing of this. Should the Paired End PCR Primers be modified in such a way?
  Reply With Quote
Old 08-30-2010, 07:56 AM   #67
pedstunite
Junior Member
 
Location: New York

Join Date: Jul 2010
Posts: 1
Default overhang on adapters not for ligation purposes

Hi,

I have the same question regarding the adapter sequence. I can't understand why there is an overhang on the 5' end of an illumina adapter sequence (not the overhang needed for ligation). B/c this sequence is amplified by PCR anyways, I don't see the need for an overhang. Anyone know???

Thx
pedstunite is offline   Reply With Quote
Old 08-30-2010, 10:41 AM   #68
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

Quote:
Originally Posted by clz8782 View Post
I have ordered Illumina's paired end primers and had low yield of PCR amplicons of my library. I was sent supplemental information from this nature paper. http://www.nature.com/nature/journal...re07517-s1.pdf

This states that the PCR primers should have a phosphorothioate bond at the 3' end:

5-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGC
TCTTCCGATCxT and 5-
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTT
CCGATCxT (x = phosphorothioate bond resistant to excision by 3-5 exonucleases).

This is the first I am hearing of this. Should the Paired End PCR Primers be modified in such a way?
I believe this is because they use proof-reading polymerase in the PCR reaction. We use locked nucleic acids instead of phosphorothioate modifications since this is what the Tufts protocol recommends. If you don't modify the primers the yield will be much lower.
NextGenSeq is offline   Reply With Quote
Old 09-13-2010, 07:41 AM   #69
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Hi,

Does anybody got the idea regarding the adaptor sequence use for small RNA seq data of ILLUMINA IDEA CHALLENGE?
http://www.illumina.com/landing/idea/
Thanks a lot for sharing.
edge is offline   Reply With Quote
Old 09-13-2010, 07:46 AM   #70
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

From the following link, http://intron.ccam.uchc.edu/groups/t...Sequences.html

Small RNA oligonucleotide sequences
5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Do I need to convert the "U" to "T" before I start trimming the adaptor sequence in my raw data?
Besides that, what is the "id" in 3' RNA Adapter refer to?
Thanks for any advice.
edge is offline   Reply With Quote
Old 12-23-2010, 11:09 PM   #71
MW007
Junior Member
 
Location: Chi town

Join Date: Sep 2010
Posts: 2
Default tru-seq adapters?

Does anyone know if the new tru-seq system uses different adapters; i.e. different sequences than those posted below?
MW007 is offline   Reply With Quote
Old 01-13-2011, 07:56 AM   #72
genlyai
Member
 
Location: Boston, MA

Join Date: Aug 2009
Posts: 39
Default

MW007, I've heard truseq does use new seqs for some oligos, but I'm not sure which. If anyone can answer this -- possibly we can get a start just from looking at a run that's used Truseq -- that would be great.

Another thing I didn't see on here is sequences of the barcode primers (from pre-truseq days). Can anybody help with that?
genlyai is offline   Reply With Quote
Old 01-24-2011, 06:15 PM   #73
seqgirl123
Member
 
Location: U.S

Join Date: Oct 2008
Posts: 74
Default anyone use qPCR primers during library prep?

Does anyone use the qPCR primers sold by Applied Biosystems to amplify their PCR product? Their qPCR primer sequences they sell are identical to Illumina's flowcell oligos 'P5' and 'P7'.

Taking an example, say you have a genomic paired-end library and for whatever reason, there's low library yield after PCR cleanup. So you decide to reamplify. But instead of reamplifying with the primers again (which is the common route), does anyone use the qPCR primers instead? The reasoning behind it is that your library now contains the regions complementary to flowcell oligos, so the qPCR primers can be used for reamplification instead of the PE-primers. I am not sure how this would help though. Perhaps because the qPCR primers are same as flowcell oligos, they will amplify the material better and thus will lessen PCR bias, and give higher quality sequencing data? Has anyone ever heard of this?

On another note, I haven't heard of people using the qPCR primers in place of PE primers however, and not sure if it can be done either. I haven't checked it out myself.
seqgirl123 is offline   Reply With Quote
Old 01-25-2011, 02:20 PM   #74
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

We use the KAPA library quantification kit. It comes with everything you need and works very well.
NextGenSeq is offline   Reply With Quote
Old 01-27-2011, 06:12 PM   #75
seqgirl123
Member
 
Location: U.S

Join Date: Oct 2008
Posts: 74
Default

Do you ever use the KAPA GAIIx qPCR primers for library re amplification before putting the library onto the cluster station?
seqgirl123 is offline   Reply With Quote
Old 01-31-2011, 07:46 AM   #76
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

No, not sure why you would do that. The more amplification you do in your library prep the more artifacts you create.
NextGenSeq is offline   Reply With Quote
Old 02-01-2011, 05:09 PM   #77
seqgirl123
Member
 
Location: U.S

Join Date: Oct 2008
Posts: 74
Default

NextGenSeq, it is a trick some people apply when their DNA yield is low after PCR cleanup in library prep. They amplify with qPCR primers to increase the yield, I guess this ends up more closely representing cluster amplification in some ways, so it won't necessarily create more artifacts or bias like regular PCR amplification would, but give better tighter PCR amplification of target. I am not sure if I have all the details right though about this trick. Was hoping that anyone here has tried it can comment on their experiences.
seqgirl123 is offline   Reply With Quote
Old 02-15-2011, 05:05 PM   #78
seqfan05
Junior Member
 
Location: China

Join Date: Sep 2010
Posts: 5
Default

Quote:
Originally Posted by sci_guy View Post
Do pages 17 - 20 of this help?
I can not find the page17-20, How does it describe?
seqfan05 is offline   Reply With Quote
Old 03-05-2011, 12:20 PM   #79
seqgirl123
Member
 
Location: U.S

Join Date: Oct 2008
Posts: 74
Default

[post deleted]

Last edited by seqgirl123; 03-05-2011 at 12:23 PM. Reason: wrong thread
seqgirl123 is offline   Reply With Quote
Old 04-28-2011, 01:54 PM   #80
shoegame2001
Member
 
Location: California

Join Date: Dec 2010
Posts: 21
Default

Does anyone know the concentration of the indexed adapters in the TruSeq RNA sample prep kit? Or alternatively, what concentration of custom-made primers from IDT or elsewhere have people had success with integrating into the TruSeq protocol?

Thanks!

Last edited by shoegame2001; 05-01-2011 at 08:52 AM.
shoegame2001 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:26 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO