Hi
I have started using SHRiMP mapping tool. And following are few doubts.
1. Do I have convert solexa reads into fasta format and then run command as below:
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/test1.out
If I don't convert solexa sequence into fasta format (i.e appending '>' in the beginning of the sequence) then
does throw some error and I convert the reads into fasta format, then I am able to split the sequence file insto 1000 sequences per file.
But I get an error when I try to run rmapper-ls as below
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/res.0_to_999.out
Loading reads...error: read [NATGATGCAGGAACATAAAGGACTGGTCATCTTGG] had no sequence!
Hence I changed the read format as below:
ATGCATGCGCATCGATCGATCGT
ATCGTACGATCGTACGTACGTAG
..
and run rmapper but the results are as below:
Please let me know the input query sequence format? Thanks.
I have started using SHRiMP mapping tool. And following are few doubts.
1. Do I have convert solexa reads into fasta format and then run command as below:
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/test1.out
If I don't convert solexa sequence into fasta format (i.e appending '>' in the beginning of the sequence) then
Code:
python ../SHRiMP_1_2_0/utils/splitreads.py 1000 read1.fasta
But I get an error when I try to run rmapper-ls as below
../SHRiMP_1_2_0/bin/rmapper-ls -s 111111011111 -n 3 -w 35 -o 20 -r 32 -d -1 -h 2675 test1.txt /../hg18/*.fa > ../results/res.0_to_999.out
Loading reads...error: read [NATGATGCAGGAACATAAAGGACTGGTCATCTTGG] had no sequence!
Hence I changed the read format as below:
ATGCATGCGCATCGATCGATCGT
ATCGTACGATCGTACGTACGTAG
..
and run rmapper but the results are as below:
General:
Reads Matched: 0 (0.0000%)
Total Matches: 0
Avg Hits/Matched Read: 0.00
Duplicate Hits Pruned: 0
Reads Matched: 0 (0.0000%)
Total Matches: 0
Avg Hits/Matched Read: 0.00
Duplicate Hits Pruned: 0
Comment