SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA produces odd alignment results dandyrilla Bioinformatics 2 11-28-2011 12:28 AM
view alignment and assembling results with UCSC genome browser? dicty Bioinformatics 1 03-04-2011 08:38 AM
Colorspace alignment visualization zee Bioinformatics 5 05-12-2010 11:47 AM
MAQ - colorspace alignment troubles Jonathan Bioinformatics 1 01-20-2010 11:16 PM
sam output from bwa colorspace alignment Mr Mutundes Bioinformatics 0 12-15-2009 04:02 AM

Reply
 
Thread Tools
Old 11-10-2011, 08:18 AM   #1
dsidote
Member
 
Location: New Jersey

Join Date: Aug 2009
Posts: 23
Default SHRiMP alignment results for colorspace miRNA

I'm trying to use SHRiMP to analyze a miRNA dataset using AB colorspace reads. I noticed when looking at the alignments using the pretty print option (-P) that SHRiMP aligns bases to the end of a read rather than the next base in the sequence. Does anyone know how to stop this behavior? I've tried various options but haven't figured out the solution yet.

Here is an example. the read and the reference are both ACTGTGGGCCCTTTCCGCACCA, yet SHRiMP aligns an A to the end of the read and calls it an insertion of AATCACCG.

>3_306_617 MIR-675Y_HSA-MIR-675___ - 1 22 1 30 30 129 12T8(AATCACCG)1
ACTGTGGGCCCTCTCCGCACC--------A 1
ACTGTGGGCCCTTTCCGCACCAATCACCGA
212111003002002033110103211032 30
Attached Images
File Type: png Screen Shot 2011-11-10 at 10.02.34 AM.png (35.6 KB, 8 views)

Last edited by dsidote; 11-10-2011 at 08:29 AM.
dsidote is offline   Reply With Quote
Old 11-10-2011, 10:22 AM   #2
brentp
Member
 
Location: salt lake city, UT

Join Date: Apr 2010
Posts: 72
Default

That may be because it does a global alignment by default, you could try setting either the --local or --bfast flags to gmapper-cs and see if that helps.
brentp is offline   Reply With Quote
Old 11-10-2011, 10:32 AM   #3
dsidote
Member
 
Location: New Jersey

Join Date: Aug 2009
Posts: 23
Default

Aside from the read counts, I would also like to know what bases this particular enzyme adds to the end of the miRNA during amplification. I tried using the local setting and it does change the way SHRiMP reports the aligned reads, that is, its no longer reporting gaps where there shouldn't be, but it no longer reports the end of the read that does not align. I'll give the bfast option a try. Thanks.
dsidote is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:46 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO