SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq indexing with Custom Select Oligos dcarter Core Facilities 2 01-15-2015 06:10 AM
Oligos from Peterson et al. (2011) maxbangs Illumina/Solexa 2 05-21-2014 11:09 AM
Blocking oligos in MiSeq kit LSAD Sample Prep / Library Generation 0 04-13-2012 01:09 AM
Oligos on the flowcell -- how'd they get there? MrGuy Illumina/Solexa 1 10-31-2011 10:57 AM
PubMed: ZOOM! Zillions Of Oligos Mapped. Newsbot! Literature Watch 3 08-21-2008 06:52 AM

Reply
 
Thread Tools
Old 06-06-2016, 01:43 PM   #1
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 49
Default P5/P7 Flowcell Oligos

I apologize if this has been hashed out already, but I cannot seem to find any definitive documentation which describes whether the flowcell oligos are P5 and P7, or the complements. I know Illumina considers this information proprietary so it's not immediately obvious to me. I am wondering whether or not an excess of free P5 and P7 custom PCR primer (not dimer) would bind to the flowcell. I understand why dimers (which amplify and thus contain both P5/complement to P5, etc) would bind to the flowcell, but what about just these oligos?

My primers are:
SLXP5_PCR - AATGATACGGCGACCACCGAG
SLXP7_PCR - CAAGCAGAAGACGGCATACGAG

Anybody have a good, clear resource on this?

Thanks in advance!
jlove is offline   Reply With Quote
Old 06-06-2016, 03:16 PM   #2
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,179
Default

Those oligos will not bind to flow cell oligo lawn but may bind to library strands reducing their effective concentration resulting in under clustering. Flow cell oligos for SE and PE flow cells are as following:

PE: 5-PS-TTTTTTTTTT---------AATGATACGGCGACCACCGAGAUCTACAC-3
SE: 5-PS-TTTTTTTTTT-(diol)3-AATGATACGGCGACCACCGA-3

PE: 5-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGAGoxoAT-3
SE: 5-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3
nucacidhunter is offline   Reply With Quote
Old 06-13-2016, 07:24 AM   #3
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 49
Default

This is very handy, thank you! May I ask how you figured out these sequences?
Jen


Quote:
Originally Posted by nucacidhunter View Post
Those oligos will not bind to flow cell oligo lawn but may bind to library strands reducing their effective concentration resulting in under clustering. Flow cell oligos for SE and PE flow cells are as following:

PE: 5-PS-TTTTTTTTTT---------AATGATACGGCGACCACCGAGAUCTACAC-3
SE: 5-PS-TTTTTTTTTT-(diol)3-AATGATACGGCGACCACCGA-3

PE: 5-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGAGoxoAT-3
SE: 5-PS-TTTTTTTTTTCAAGCAGAAGACGGCATACGA-3
jlove is offline   Reply With Quote
Old 06-13-2016, 10:40 PM   #4
nucacidhunter
Jafar Jabbari
 
Location: Melbourne

Join Date: Jan 2013
Posts: 1,179
Default

I have got it somewhere from a google search years ago, so the base modification may not be applicable to two colour chemistry or patterned flow cells. I think the sequences are still the same as old and new adapters share flow cell binding motives and when library fragments are shorter than cycle number a long stretch of A after adapter sequences are observed that are complementary to T homopolymer.
nucacidhunter is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:55 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO