SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 12:52 PM
Miseq custom primer design, primer linker Cyrus Taheri Illumina/Solexa 1 04-21-2015 06:25 PM
Short LNA custom sequencing primer for MiSeq bunce Illumina/Solexa 1 02-24-2014 02:14 AM
Primer and adapter design for small RNA sequencing in HiSeq2000 and MiSeq windhorse8 Illumina/Solexa 3 10-09-2013 07:39 AM
[question] reads detected sequences out of sequencing primer in the other direction SF_mallish Bioinformatics 2 12-06-2012 02:55 PM

Reply
 
Thread Tools
Old 07-21-2015, 10:27 AM   #1
enum
Junior Member
 
Location: usa

Join Date: Jul 2015
Posts: 2
Default MiSeq sequencing primer question

We are trying to do single-cell TCR sequencing using Mark Davis protocol based on his 2015 Nature Biotech publication. The link for the paper is:
http://www.nature.com/nbt/journal/v3.../nbt.2938.html
We used the same primer set as the paper. The PE primers for the final PCR reaction are:
PEprimer1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PEprimer2: AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT

My questions are:
1. I can see PEprimer1 contains P5 sequence primer. What is PEprimer2? What should I use for the other end of sequence primer?
2. For the final (third) PCR reaction, do we have to use PAGE purified PEprimer1 and PEprimer2? Do we need to order PE primers modified with phosphorothioate bonds between the two last (3') nucleotides according to Illumina’s Nature Method paper? Or this is just for the sequencing part?

Thank you so much!
enum is offline   Reply With Quote
Old 07-13-2016, 07:25 AM   #2
al02145
Junior Member
 
Location: Boston

Join Date: Jun 2016
Posts: 1
Default

Hi enum,
Did you succeed with single-cell TCR sequencing?
I just ordered Mark Davis primes. I tried Smarter kit with not much success.
I'll appreciate your help.
al02145 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:18 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO