BBSplit assertion error: invalid fasta file

PinkTips · 02-11-2019, 07:43 AM

Good morning, BBMappers!

I have been trying to run BBSplit (on my university's computing cluster) to remove host sequences from metatranscriptome data of a gut community.

This is the command I am using:

Code:

/home/hd55218/BBSplit/bbmap/bbsplit.sh in=/home/hd55218/BBSplit/QualTrimmed_bran11.fasta ref=/home/hd55218/BBSplit/p.americana_genome.fasta,/home/hd55218/BBSplit/Blattabacterium_genome.fasta basename=out_%.fasta outu=/home/hd55218/BBSplit/cleaned_bran11.fasta

The error message returned after running on the cluster is :

Quote:

Exception in thread "main" java.lang.AssertionError: Invalid input file: '/home/hd55218/BBSplit/QualTrimmed_bran11.fasta'
at align2.AbstractMapper.preparse0(AbstractMapper.java:821)
at align2.AbstractMapper.<init>(AbstractMapper.java:53)
at align2.BBMap.<init>(BBMap.java:43)
at align2.BBMap.main(BBMap.java:31)
at align2.BBSplitter.main(BBSplitter.java:47)

The first four sequences in my FASTA file appear as:

Quote:

>NB502039:96:HGLYGBGX3:1:11101:19340:2795 1:N:0:AGTTCC
GTCCTCTTCCGGGGTCTGGGTGCCAAGGCCCATCGCCTGCAGACCTTCGTTCAGCGGGGTGTACACGGGGCCTTCGAATGCGCCATCGATGACCACGGTCGTCTTGTCATACTCGTTGCCGAAGTTCGCCATTTCGATCTGCAGCGGCTCCAGATCCAGCGTGGTGTAGTCGATGTCCACACGGCTGGGGGGGGGCACGCCGCCGGTGACGAGCCTGTAGGTCTGGCACTCCCC
>NB502039:96:HGLYGBGX3:1:11101:23904:2797 1:N:0:AGTTCC
CCGCCTTCAACGCCAAGAGCGCGAATTATGCGTATAGATGCACTTCTAAGCATCATGAGTTCTCTATCAGAAAGTGTTTGCGCAGGAGCTGCAACTATACTGTCACCTGTATGAACACCAACAGGGTCAAGGTTTTCCATCGAACAAATCGTAATGCAGTTATCTGCG
>NB502039:96:HGLYGBGX3:1:11101:16907:2810 1:N:0:AGTTCC
GGCACCGAACGCCTTGGCAGCCAAAGCCATAGCCGGCACGAACTGACGGTCGCCGACCGTCTTGCCGCCGCCCGCTCCGGGACGCTGCACCGAGTGGGTACAGTCCATTATCACGCGTGGCGTTATCTGCTTCATATCGGGAATATTGCGGAAATCAACCACCAAGTTATTGTACCCGAAGCTGTTGCCTCGCTCTATCAACCACACGTTTTCGTTACCGCTCTCGCGCACTTTCTGCACGG
>NB502039:96:HGLYGBGX3:1:11101:20216:2823 1:N:0:AGTTCC
TAAAGGCAAATGGCTCTATCATGAAATCCTGGAGCCGGGCGTGTTGGTGCATGTTTCTGAGAGCGGTGCCAAAGTATGGACCGTTCGCTGTGGTTCCCCCCGTCTGGTAACGGTCAATTATGTTCGCG

This FASTA file was converted from a FASTQ file using:

Code:

paste - - - - < Qualtrimmed_bran11.fastq | cut -f 1,2 | sed 's/^@/>/' | tr "\t" "\n" > Qualtrimmed_bran11.fasta

I am stumped as to why my FASTA format is invalid, so any thoughts/help would be greatly appreciated! Thanks!

GenoMax · 02-11-2019, 12:26 PM

Do you get an error right away or does the program run for some time?

Are these bbmerged reads? Wonder if you should try to do the binning with original fastq data. Is that a possibility?

PinkTips · 02-11-2019, 12:37 PM

From what I can tell, the error shows up right away. I only get an email when my job is finished on the cluster, but the log file shows the error appearing right away (right after the reference files are merged).

Yes, these reads were merged with bbmerge.

I was under the impression that bbsplit wanted the reads as FASTA files, but I will try with the FASTQ files!

Thank you, and I will let you know how it goes!

GenoMax · 02-11-2019, 03:20 PM

BBSplit will take fastq reads and bin them. Let me know how that works.

You can convert the merged fastq reads afterwards with

Code:

reformat.sh in=merged.fq.gz out=merged.fa

No paste/cut/sed needed :-)

PinkTips · 02-12-2019, 07:58 AM

Unfortunately, I get the same assertion error as before when I use my FASTQ file.

The first few sequences of the FASTQ file:

Quote:

@NB502039:96:HGLYGBGX3:1:11101:19340:2795 1:N:0:AGTTCC
GTCCTCTTCCGGGGTCTGGGTGCCAAGGCCCATCGCCTGCAGACCTTCGTTCAGCGGGGTGTACACGGGGCCTTCGAATGCGCCATCGATGACCACGGTCGTCTTGTCATACTCGTTGCCGAAGTTCGCCATTTCGATCTGCAGCGGCTCCAGATCCAGCGTGGTGTAGTCGATGTCCACACGGCTGGGGGGGGGCACGCCGCCGGTGACGAGCCTGTAGGTCTGGCACTCCCC
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEAEEEEEEEEEEEEEEEE6EEEEEEEEEEEEEJJJJHJHJHJJJJJJJJJJJDJGFJJJJJJHJJJJJJJJHJ?JHJJJJJJJHJJ7JHJJHJJJJJHJEEEEEEEEEEE/EEAE/EEAA/E/E/EEEEEEEEE/AEEEE/EEEEEAEE/EEEEEAEEEE/EAEEAAEEE/AE/EEEAAAAAA
@NB502039:96:HGLYGBGX3:1:11101:23904:2797 1:N:0:AGTTCC
CCGCCTTCAACGCCAAGAGCGCGAATTATGCGTATAGATGCACTTCTAAGCATCATGAGTTCTCTATCAGAAAGTGTTTGCGCAGGAGCTGCAACTATACTGTCACCTGTATGAACACCAACAGGGTCAAGGTTTTCCATCGAACAAATCGTAATGCAGTTATCTGCG
+
AAAAAEEEEEEEEEEEEEEJJJJJJJHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJEEEEEEEEEEEEAAAAA
@NB502039:96:HGLYGBGX3:1:11101:16907:2810 1:N:0:AGTTCC
GGCACCGAACGCCTTGGCAGCCAAAGCCATAGCCGGCACGAACTGACGGTCGCCGACCGTCTTGCCGCCGCCCGCTCCGGGACGCTGCACCGAGTGGGTACAGTCCATTATCACGCGTGGCGTTATCTGCTTCATATCGGGAATATTGCGGAAATCAACCACCAAGTTATTGTACCCGAAGCTGTTGCCTCGCTCTATCAACCACACGTTTTCGTTACCGCTCTCGCGCACTTTCTGCACGG
+
AAAAAEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEEEEEEEEEEEEEEEEEEEE/EEEEEEAEEEJJJJJJJJJJJJJJJJJIJJJJJJJJJJJJJJHJJJJJJJJJJJJJJJJJHJJJJJJJJEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAAAAA
@NB502039:96:HGLYGBGX3:1:11101:20216:2823 1:N:0:AGTTCC
TAAAGGCAAATGGCTCTATCATGAAATCCTGGAGCCGGGCGTGTTGGTGCATGTTTCTGAGAGCGGTGCCAAAGTATGGACCGTTCGCTGTGGTTCCCCCCGTCTGGTAACGGTCAATTATGTTCGCG
+
DFDDJJH77HJHJHJHJHJHJJJHJHJHJJJJJJH77JHHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJ

GenoMax · 02-12-2019, 10:09 AM

Can you validate your fastq files to make sure there are no errors in the file?

Use validateFiles from Kent Utilities (UCSC). Linux version linked. After download add execute permissions (chmod a+x validateFiles) before running.

validateFiles -type=fastq file1.gz file2.gz etc

PinkTips · 02-12-2019, 11:31 AM

I used

Code:

validateFiles -type=fastq QualTrimmed_bran11.fastq

and the output was

Quote:

Error count 0

When I used

Code:

validateFiles -type=fastq QualTrimmed_bran11.fasta

the output was

Quote:

Error [file=QualTrimmed_bran11.fastq, line=1]: sequence name first char invalid (got '@', wanted '>') [@NB502039:96:HGLYGBGX3:1:11101:19340:2795 1:N:0:AGTTCC]
Aborting .. found 1 error

So I figured it was working properly.

(I am using v38.22)

GenoMax · 02-12-2019, 12:40 PM

I am wondering if the error you are seeing is a red herring. How much memory are you allocating to this job on the cluster (bbsplit can need a lot of memory depending on size of the reference genomes).

You should explicitly add "-Xmx20g" (this is 20 gig, just an example) flag to your bbsplit command. Make sure you match the sample amount of memory on the cluster side.

On a side note:

Code:

validateFiles -type=fastq QualTrimmed_bran11.fasta

generated an error since you need to change the type to fasta to match. So try

Code:

validateFiles -type=fasta QualTrimmed_bran11.fasta

PinkTips · 02-12-2019, 01:01 PM

I was only allotting 2GB from the cluster side, likely not enough for BBSplit to do its thing!
I've tried again with "-Xmx200gb" and will let you know how it goes!

Thanks - I never would have gotten that from java's error message!

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Cuffdiff error [bam_header_read] invalid BAM binary header (this is not a BAM file).	adrian	Bioinformatics	0	12-29-2016 02:23 PM
.gtf file issue - Error at parsing .tlst line (invalid strand):	4galaxy7	Bioinformatics	1	11-05-2015 04:42 AM
Assertion failed error in BFAST localalign	seeker	Bioinformatics	7	09-02-2011 10:33 PM
Samtools Pileup Assertion Error	AnamikaDarwin	Bioinformatics	2	06-29-2009 01:44 PM

02-11-2019, 03:20 PM	#4
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 6,845	BBSplit will take fastq reads and bin them. Let me know how that works. You can convert the merged fastq reads afterwards with Code: reformat.sh in=merged.fq.gz out=merged.fa No paste/cut/sed needed :-)

02-12-2019, 12:40 PM	#8
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 6,845	I am wondering if the error you are seeing is a red herring. How much memory are you allocating to this job on the cluster (bbsplit can need a lot of memory depending on size of the reference genomes). You should explicitly add "-Xmx20g" (this is 20 gig, just an example) flag to your bbsplit command. Make sure you match the sample amount of memory on the cluster side. On a side note: Code: validateFiles -type=fastq QualTrimmed_bran11.fasta generated an error since you need to change the type to fasta to match. So try Code: validateFiles -type=fasta QualTrimmed_bran11.fasta

02-11-2019, 12:26 PM	#2
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 6,845	Do you get an error right away or does the program run for some time? Are these bbmerged reads? Wonder if you should try to do the binning with original fastq data. Is that a possibility?

02-11-2019, 12:37 PM	#3
PinkTips Junior Member Location: Athens, GA Join Date: Feb 2019 Posts: 5	From what I can tell, the error shows up right away. I only get an email when my job is finished on the cluster, but the log file shows the error appearing right away (right after the reference files are merged). Yes, these reads were merged with bbmerge. I was under the impression that bbsplit wanted the reads as FASTA files, but I will try with the FASTQ files! Thank you, and I will let you know how it goes!

02-12-2019, 10:09 AM	#6
GenoMax Senior Member Location: East Coast USA Join Date: Feb 2008 Posts: 6,845	Can you validate your fastq files to make sure there are no errors in the file? Use validateFiles from Kent Utilities (UCSC). Linux version linked. After download add execute permissions (chmod a+x validateFiles) before running. validateFiles -type=fastq file1.gz file2.gz etc

02-12-2019, 01:01 PM	#9
PinkTips Junior Member Location: Athens, GA Join Date: Feb 2019 Posts: 5	I was only allotting 2GB from the cluster side, likely not enough for BBSplit to do its thing! I've tried again with "-Xmx200gb" and will let you know how it goes! Thanks - I never would have gotten that from java's error message!