![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
Bowtie, an ultrafast, memory-efficient, open source short read aligner | Ben Langmead | Bioinformatics | 514 | 03-13-2020 04:57 AM |
Introducing BBMap, a new short-read aligner for DNA and RNA | Brian Bushnell | Bioinformatics | 24 | 07-07-2014 10:37 AM |
Miso's open source | joyce kang | Bioinformatics | 1 | 01-25-2012 07:25 AM |
Targeted resequencing - open source | stanford_genome_tech | Genomic Resequencing | 3 | 09-27-2011 04:27 PM |
EKOPath 4 going open source | dnusol | Bioinformatics | 0 | 06-15-2011 02:10 AM |
![]() |
|
Thread Tools |
![]() |
#621 |
Senior Member
Location: oceania Join Date: Feb 2014
Posts: 115
|
![]() |
![]() |
![]() |
![]() |
#622 |
Senior Member
Location: oceania Join Date: Feb 2014
Posts: 115
|
![]()
Ok I thought this was solved, but see below, still getting sam file alignments with MAPQ=3, even though they actually look like good alignments. Is '3' given because you can't calculate a perfect hit MAPQ? i.e. MAPQ=-10*log10(zero)
@PG ID:BBMap PN:BBMap VN:37.93 CL:java -Djava.library.path=/bin/bbmap/jni/ -ea -Xmx43986m align2.BBMap build=1 overwrite=true fastareadlen=500 ref=genome/genome.fasta ambig=best vslow perfectmode maxsites=10000 nzo=t mappedonly=t outu=test/unmapped/testKT45.unmapped.fasta scafstats=test/mapped/testKT45.map in=testKT45.fastq out=test/mapped/testKT45.sam -idfilter=0.9 700666F:325:CCC50ANXX:6:2211:7729:2233 1:N:0:GTCGAG 0 ctg3849_RHIMB__RM170330.3849 Backbone_3849|arrow|pilon 111580 3 31= * 0 0 GCATTGGTGGTTCAGTGGTAGAATTCTCGCC CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGG XT:A:R NM:i:0 AM:i:3 700666F:325:CCC50ANXX:6:2211:7914:2047 1:N:0:GTAGAG 16 ctg18961_RHIMB__RM170330.18961 Backbone_18961|arrow|pilon 20097 3 31= * 0 0 TCACAATGATAGGAAGAGCCGACATCGAAGG GGGGGGGGGGGGGGGGGGGGGGGGGGCCCCC XT:A:R NM:i:0 AM:i:3 700666F:325:CCC50ANXX:6:2211:7905:2066 1:N:0:GTCGAG 16 ctg18961_RHIMB__RM170330.18961 Backbone_18961|arrow|pilon 34735 3 31= * 0 0 GGTAGGCGCAGAAAGTACCATCGAAAGTTGA GGGGGFGGGGGGGGGGGGGGGGGGGGCCCCC XT:A:R NM:i:0 AM:i:3 700666F:325:CCC50ANXX:6:2211:7970:2099 1:N:0:GTCGAG 0 ctg16585_RHIMB__RM170330.16585 Backbone_16585|arrow|pilon 33974 3 23= * 0 0 GGGAATACCAGGTGCTGTAGGCT CCCCCGEGGGGGGGGGGGGGGGG XT:A:R NM:i:0 AM:i:3 700666F:325:CCC50ANXX:6:2211:7937:2145 1:N:0:GTCGAG 16 ctg13544_RHIMB__RM170330.13544 Backbone_13544|arrow|pilon 7627 3 39= * 0 0 GGTGAGAGCGCCGAATCCTAACCACTAGACCACCAGGGA GGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGCCCCC XT:A:R NM:i:0 AM:i:3 |
![]() |
![]() |
![]() |
#623 |
Member
Location: california Join Date: Feb 2012
Posts: 35
|
![]()
Hi Brian - Is there a bbtool that will keep only mapped reads and if the mate doesn't map output the unmapped also from sam/bam files?
Thanks |
![]() |
![]() |
![]() |
#624 | |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
#625 | |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]() Quote:
Code:
reformat.sh in=data.sam out=mapped.sam mappedonly reformat.sh in=data.sam out=unmapped_mates_of_mapped_reads.sam requiredbits=4 filterbits=8 Code:
reformat.sh in=data.sam out=mapped.sam mappedonly filterbyname.sh in=data.sam names=mapped.sam include=t out=mapped_or_mate_mapped.sam |
|
![]() |
![]() |
![]() |
#626 |
Junior Member
Location: Spain Join Date: Oct 2017
Posts: 2
|
![]()
Hi Brian! Hope I'm posting this in the right place.
I've been using clumpify for a while. Great tool! I was totally blown away by how fast it is... Simple question. I noticed that you make the following recommendations for detection of optical duplicates: dupedist=40 (dist) Max distance to consider for optical duplicates. Higher removes more duplicates but is more likely to remove PCR rather than optical duplicates. This is platform-specific; recommendations: NextSeq 40 (and spany=t) HiSeq 1T 40 HiSeq 2500 40 HiSeq 3k/4k 2500 Novaseq 12000 I was surprised to see that NovaSeq has such a big distance. Is this something you have measured? I have only been able to find the Picard recommendation which groups all the patterned flowcells with the same distance (2500). Thanks! |
![]() |
![]() |
![]() |
#627 |
Super Moderator
Location: Walnut Creek, CA Join Date: Jan 2014
Posts: 2,707
|
![]()
The coordinate system varies across platforms; the physical distance of 1 pixel is much larger on HiSeq 2500 than HiSeq 3000/4000m for example.
NovaSeq has unique problems, though. The distance of 12000 is not really to catch optical duplicates, but rather, clonal colonies that presumably form when a molecule breaks off from a colony and forms a new colony nearby (typically downstream). These have a high degree of positional correlation but are not actually adjacent; they can be fairly distant. They are not even necessarily on the same tile, so Clumpify won't catch all of them when it is restricted to looking for duplicates only within a tile. And yes, the 12000 comes from empirical testing. That catches most of the duplicates formed by this mechanism. I think I posted the approximate amount somewhere... maybe it was around 85%? You can't get all of them unless you completely disregard position and remove all duplicates. |
![]() |
![]() |
![]() |
#628 | |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
We had a discussion about what the x:y coordinates mean on Biostars.
Short take home from poster of that thread was: Quote:
|
|
![]() |
![]() |
![]() |
#629 | |
Senior Member
Location: oceania Join Date: Feb 2014
Posts: 115
|
![]() Quote:
Thanks, S. |
|
![]() |
![]() |
![]() |
#630 | |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
#631 |
Junior Member
Location: Germany Join Date: Aug 2013
Posts: 6
|
![]()
(Apologies if this shows up more than once, my posts keep disappearing...)
Hello Brian et al., The bitflags don't seem to be assigned correctly when the ambig=all option is used. The renaming of read pairs with keepnames=f also appears to be affected. I am mapping Illumina paired reads with ambig=all to report all ambiguous alignments. From what I understand, the secondary alignments are indicated with the bitflag 0x100. For paired input, the alignments appear to be reported in the following order for each read pair:
I observed that with keepnames=f, there are two bugs (example below):
With keepnames=t, the original names are retained for both forward and reverse reads in both primary and secondary alignments, but the second bug above (misassignment of bitflags 0x40 and 0x80) is still there. I first noticed the problem with bbmap v37.76 but it still occurs in v37.99. Maybe I'm overlooking something, but this seems to be a bug. Has anyone else encountered this before? My apologies if this has been posted to this thread before. I didn't find anything relevant with search keywords 'keepnames' and 'ambiguous'. Thank you! ** Examples ** Alignment columns QNAME and FLAG from SAM file with keepnames=f for a read pair showing the error Code:
HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 99 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 147 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 Code:
HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 99 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 1:N:0:AAGGGAAT 353 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 147 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 HWI-ST863:279:H03F7ADXX:1:1107:5049:39482 2:N:0:AAGGGAAT 337 |
![]() |
![]() |
![]() |
#632 |
Junior Member
Location: France Join Date: Feb 2013
Posts: 6
|
![]()
Dear BBMap programmers/users,
First of all, I want to thank you for your work. This set of tools is very pleasant to use and very well documented. Moreover, the pipeline are very useful and very well explained. This is very easy easy to adapt them. Nevertheless, as this is the first time I am using BBMap, on a really specific problem, I have few questions (you can find an explanation of my problem here: http://seqanswers.com/forums/showthread.php?t=81997). I used the variantPipeline.sh pipeline adapted for multiple paired non-covering amplicon data files: - Does BBMap support IUPAC nucleotide code for building the reference genome index? - As I will map distant (or polymorph) reads on my reference, I used "k=8" for building the index. is it possible to lower this value and is it useful? - filterbytile.sh, for trimming the adaptater does not take input file describing my adapters (Nextera...)? Is it normal? - bbduk.sh, removing the sequencing artifact, take default files (ref=${BBMAPRESSOURCES}/sequencing_artifacts.fa.gz,${BBMAPRESSOURCES}/phix174_ill.ref.fa.gz). Is it commonly found artefacts? Could I use these files or must I create mine? I didn't change k=27, must I change the value due to the poor quality of my reads? - bbmap.sh, for mapping step, I used "vslow k=8 maxindel=200 minratio=0.1" parameters, as described in the online documentation (https://jgi.doe.gov/data-and-tools/b...e/bbmap-guide/). Is it a good idea with distant reference genome and poor quality data? - callvariants.sh, for the variants call step, I let the ploidy=1. I'm working on various plants and I don't really know the ploidy. Must I let this parameter to 1? I'm only looking for SNPs, Is it possible to specify it to the scripts? - Finally, is it really useful to add optional error-correction and recalibration step of my reads, before performing the mapping? Will I lose some important data? I know some questions are trivial, but I'm still reading the manual and the different scripts documentations... Thanks in advance for your help. Denis |
![]() |
![]() |
![]() |
#633 | |
Member
Location: Philadelphia Join Date: Jan 2012
Posts: 58
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
#634 |
Member
Location: Louisiana Join Date: Nov 2013
Posts: 38
|
![]()
Hi Brian,
Does bbmap callvariants.sh ignore duplicates marked by picard MarkDuplicates by default (or is there an option to ignore duplicates) or do duplicates have to be deleted? Best, Gopo |
![]() |
![]() |
![]() |
#635 |
Member
Location: california Join Date: Feb 2012
Posts: 35
|
![]()
Hi Brian,
I'm using trimrname=t from reformat.sh on a sam file. It looks like it trims the ref names correctly on the alignment lines, but not in header lines (the ones that start with @). |
![]() |
![]() |
![]() |
#636 |
Member
Location: Japan Join Date: Sep 2017
Posts: 40
|
![]()
Dear Brian,
I am using bbmap for mapping and callvariants.sh for variant calling on PE Illumina reads. I am comparing two mice strains. I am therefore downsampling my .sam files to have the same number of mapped reads going into the alignment. When I input the original file containing ~680k mapped PE reads I get 2283 variants. When I run the down sampled file containing ~200k mapped PE reads I get 3375 variants. I would expect to get a lower number of variants when I put in less reads. Could you explain this to me? I am clearly missing something that might be important for my analysis ![]() (I am using the exact same criteria for variant calling and filtering for the two samples) |
![]() |
![]() |
![]() |
#637 |
Junior Member
Location: Chicago Join Date: Jul 2018
Posts: 1
|
![]()
I am trying to run BBmap on the cluster, but got the error below. Can anyone help me to solve the error?
Thanks, [hgx080@quser10 DNA_all]$ /home/hgx080/bbmap/bbmap.sh ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom java -Djava.library.path=/home/hgx080/bbmap/jni/ -ea -Xmx100g -cp /home/hgx080/bbmap/current/ align2.BBMap build=1 overwrite=true fastareadlen=500 ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa out=RNA-Ac-1_S7_filter.test.sam minid=0.95 ambig=random reads=100000 -Xmx100g -eoom Executing align2.BBMap [build=1, overwrite=true, fastareadlen=500, ref=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/assemble/final/idba/DNA-all/DNA-all-contig.fa, in=/projects/b1052/Wells_b1042/GaoHan/CANDO_RNA/clean_reads/Wells02/filter_reads/RNA-Ac-1_S7_filter.fa, out=RNA-Ac-1_S7_filter.test.sam, minid=0.95, ambig=random, reads=100000, -Xmx100g, -eoom] Version 38.11 Choosing a site randomly for ambiguous mappings. Set MINIMUM_ALIGNMENT_SCORE_RATIO to 0.908 NOTE: Ignoring reference file because it already appears to have been processed. NOTE: If you wish to regenerate the index, please manually delete ref/genome/1/summary.txt Max reads: 100000 Set genome to 1 Exception in thread "Thread-0" java.lang.RuntimeException: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream at align2.ChromLoadThread.run(ChromLoadThread.java:79) Caused by: java.lang.RuntimeException: java.io.EOFException: Unexpected end of ZLIB input stream at fileIO.ReadWrite.readObject(ReadWrite.java:806) at fileIO.ReadWrite.read(ReadWrite.java:1246) at dna.ChromosomeArray.read(ChromosomeArray.java:65) at align2.ChromLoadThread.run(ChromLoadThread.java:76) Caused by: java.io.EOFException: Unexpected end of ZLIB input stream at java.util.zip.InflaterInputStream.fill(InflaterInputStream.java:240) at java.util.zip.InflaterInputStream.read(InflaterInputStream.java:158) at java.util.zip.GZIPInputStream.read(GZIPInputStream.java:117) at java.io.ObjectInputStream$PeekInputStream.read(ObjectInputStream.java:2620) at java.io.ObjectInputStream$BlockDataInputStream.read(ObjectInputStream.java:3031) at java.io.ObjectInputStream$BlockDataInputStream.readFully(ObjectInputStream.java:3061) at java.io.ObjectInputStream.readArray(ObjectInputStream.java:1914) at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1529) at java.io.ObjectInputStream.defaultReadFields(ObjectInputStream.java:2245) at java.io.ObjectInputStream.readSerialData(ObjectInputStream.java:2169) at java.io.ObjectInputStream.readOrdinaryObject(ObjectInputStream.java:2027) at java.io.ObjectInputStream.readObject0(ObjectInputStream.java:1535) at java.io.ObjectInputStream.readObject(ObjectInputStream.java:422) at fileIO.ReadWrite.readObject(ReadWrite.java:802) ... 3 more |
![]() |
![]() |
![]() |
#638 |
Junior Member
Location: Oneonta, New York Join Date: Jul 2018
Posts: 2
|
![]()
Hello! Thanks for all of the wonderful bbmap scripts. Today I was was trying to use bbfakereads.sh but the script can not locate or open the jgi/FakeReads file. Any thoughts? I noticed a Fakereads files in the current/jgi directory. Do you think the path in the script is incorrect?
Thanks for your time and help! bbfakereads.sh in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150 java -ea -Xmx600m -cp /media/bioinformaticprograms/BBMap/sh/current/ jgi.FakeReads in=scaffolds.fasta out=fakePE_R1.fasta out2=fakePE.R2.fasta length=150 Error: Could not find or load main class jgi.FakeReads |
![]() |
![]() |
![]() |
#639 |
Senior Member
Location: East Coast USA Join Date: Feb 2008
Posts: 7,083
|
![]()
Is your bbmap installed correctly? Have you moved any files around? I am able to run "bbfakereads.sh" and generate fastq and fasta files without a problem.
|
![]() |
![]() |
![]() |
#640 |
Junior Member
Location: Oneonta, New York Join Date: Jul 2018
Posts: 2
|
![]()
You're right. It wasn't downloaded correctly. At first I used git to download the bbmap package. But when I just downloaded with wget from https://sourceforge.net/projects/bbm...p_38.12.tar.gz everything was organized correctly.
Thanks for the help. |
![]() |
![]() |
![]() |
Tags |
bbmap, metagenomics, rna-seq aligners, short read alignment |
Thread Tools | |
|
|