![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
Problem with quality of TILE | barthez95 | Illumina/Solexa | 0 | 05-30-2018 01:31 PM |
Poor per tile sequence quality | cd1 | Illumina/Solexa | 4 | 06-27-2017 02:08 PM |
Quality per tile | starbug | Illumina/Solexa | 0 | 09-20-2016 01:17 PM |
tile nomenclature | tomc | Illumina/Solexa | 8 | 04-19-2012 07:41 AM |
Sample tile images across a lane | ScottC | Illumina/Solexa | 4 | 07-06-2008 03:14 PM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: USA Join Date: Apr 2019
Posts: 1
|
![]()
Hi all,
I received some fastq files from a PE HiSeq and when I tried to isolate N reads using the "fastq_illumina_reads -N" I got the following error: Input error: file 'STDIN' line 1: Expecting Illumina-CASAVA1.8 ID line structure (@<instrument>:<run number>:<flowcell ID>:<lane>:<tile>:<x-pos>:<y-pos> <read>:<is filtered>:<control number>:<index sequence>) - got '@HS34_23148:4:1313:16347:42480/1' (Can't extract 'Tile’) ![]() The header of the file shows: @HS34_23148:4:2106:12625:73859/2 CACCAGCTGAGAGAGATGCTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGT + BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF @HS34_23148:4:1114:12855:77248/2 CTCGCCGTTGACTGACGAACTGAATTCCCAGTTCACGGCGGTATGGAATACCGTCGTCGCAGAGCTCAACGGTGA + BBBBBFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFFFFF @HS34_23148:4:1311:2663:94744/2 CTCGACAGATATTGATTGTCGTCACCGTTGAGCTCTGCGACGACGGTATTCCATACCGCCGTGAACTGGGAATTC Does anyone already get the same problem with the tile coordinates? (I could ask the facility who sent me the files an explanation but I'm not sure if the problem come from me or not) Thank you |
![]() |
![]() |
![]() |
#2 | |
Senior Member
Location: USA, Midwest Join Date: May 2008
Posts: 1,178
|
![]() Quote:
What software package is the fastq_illumina_reads program from? Does it have a command line option to switch between the old and new FastQ sequence ID line formats? |
|
![]() |
![]() |
![]() |
#3 | |
Junior Member
Location: London, UK Join Date: Aug 2019
Posts: 3
|
![]() Quote:
|
|
![]() |
![]() |
![]() |
Thread Tools | |
|
|