SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Introducing BBMerge: A paired-end read merger Brian Bushnell Bioinformatics 132 06-19-2020 04:15 AM
Converter for vcf to bed format ketan_bnf Bioinformatics 4 09-03-2013 05:43 AM
Need Sequence Format Converter byou678 Bioinformatics 5 10-23-2012 01:17 PM
BOAT aligner output format converter? rahul.m.dhodapkar Bioinformatics 0 06-30-2010 07:28 AM
MAQ .map alignment format converter fadista Bioinformatics 0 10-24-2008 06:27 AM

Reply
 
Thread Tools
Old 03-20-2018, 02:17 AM   #21
DrYak
Member
 
Location: South Africa

Join Date: Sep 2013
Posts: 12
Default

Hi,

Can I use reformat or any other bbtools script to split my fasta file into sub-files?

eg X.fa (100 sequences) -> X01.fa X02.fa....X10.fa (each with 10 sequences)?

I don't mind whether I need to select the number of sequences per file or total number of files and it doesn't really matter what order the sequences are in as long as there is no duplication of sequences.

Cheers,
Dave
DrYak is offline   Reply With Quote
Old 03-20-2018, 04:58 AM   #22
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

faSplit from Jim Kent's utilities is a much better option for splitting fasta files.

Run faSplit to look at inline help for multiple options available.
GenoMax is offline   Reply With Quote
Old 03-20-2018, 10:07 AM   #23
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Reformat won't do that, but you can use partition.sh:

Code:
partition.sh in=X.fa out=X%.fa ways=10
That will produce 10 output files with an equal number of sequences and no duplication.
Brian Bushnell is offline   Reply With Quote
Old 08-01-2018, 06:47 PM   #24
sunnycqcn
Member
 
Location: Canada

Join Date: Apr 2013
Posts: 17
Default

Hi Brian Bushnell,
when I used mapPacBio.sh for mapping pacbio reads. I met the errors as following:
Exception in thread "Thread-23" java.lang.AssertionError: Read 20, length 10550, exceeds the limit of 6019
You can map the reads in chunks by reformatting to fasta, then mapping with the setting 'fastareadlen=6019'
at align2.AbstractMapThread.run(AbstractMapThread.java:480)

But I did not find how I can reformat it.
Could you help me figure out this issue?
Thanks,
Fuyou
sunnycqcn is offline   Reply With Quote
Old 08-02-2018, 06:08 AM   #25
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

You can use
Code:
reformat.sh in=your_file.fastq out=newfile.fa
to convert the reads to fasta format.

That said I think mapPacBio.sh should automatically split reads longer than 6k when it does mapping. Is that not working?
GenoMax is offline   Reply With Quote
Old 08-02-2018, 06:29 AM   #26
sunnycqcn
Member
 
Location: Canada

Join Date: Apr 2013
Posts: 17
Default

Quote:
Originally Posted by GenoMax View Post
You can use
Code:
reformat.sh in=your_file.fastq out=newfile.fa
to convert the reads to fasta format.

That said I think mapPacBio.sh should automatically split reads longer than 6k when it does mapping. Is that not working?
It is not working. I used fasta format.
Thanks,
Fuyou
sunnycqcn is offline   Reply With Quote
Old 01-30-2019, 01:54 PM   #27
pepe84
Junior Member
 
Location: Canada

Join Date: Jul 2014
Posts: 4
Default

hello folks, I am trying to work on a FASTQ file using reformat.sh, although I have correctly installed Java and tested it in the command line, I still can't get it to work. It seems the problem is that I don't have the FASTQ file in the same directory as the BBMap folder, could that be an issue?
pepe84 is offline   Reply With Quote
Old 01-30-2019, 03:20 PM   #28
SNPsaurus
Registered Vendor
 
Location: Eugene, OR

Join Date: May 2013
Posts: 521
Default

pepe84, do you provide a path to the file? Please copy your command as tried, and then copy the error message.
__________________
Providing nextRAD genotyping and PacBio sequencing services. http://snpsaurus.com
SNPsaurus is offline   Reply With Quote
Old 01-31-2019, 05:26 AM   #29
pepe84
Junior Member
 
Location: Canada

Join Date: Jul 2014
Posts: 4
Default

here is the command:
java -cp C:\BBMap\current\jgi.ReformatReads in=“C:\BBMap\resources\SRRXXXXX.fastq” out1=EFB_R1.fq out2=EFB_R2.fq

And here is the error:
Error: Could not find or load main class in=C:\BBMap\resources\SRRXXXXX.fastq

Just an FYI I am using the command line on windows.

Thanks, I appreciate any help


Quote:
Originally Posted by SNPsaurus View Post
pepe84, do you provide a path to the file? Please copy your command as tried, and then copy the error message.
pepe84 is offline   Reply With Quote
Old 02-14-2019, 12:14 AM   #30
tolot27
Junior Member
 
Location: Germany

Join Date: Jan 2012
Posts: 3
Default deinterleave with singletons

Hi!

I have a interleaved fastq containing unmapped reads produced by segemehl -u. I want to deinterleave it into the two mate pair files as well as removing/saving the singletons into a separate file.

Currently, reformat.sh cannot deal with it, even if I give outsingle= as parameter. The header contains the strand information (i. e. 2:N:0:2).

Is there some way to get at least the pairing reads extracted without singletons in between?

--
Kind regards,
Mathias
tolot27 is offline   Reply With Quote
Old 02-14-2019, 06:50 AM   #31
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

You could use `repair.sh` to separate the singletons out afterwards.
GenoMax is offline   Reply With Quote
Old 02-15-2019, 12:45 AM   #32
tolot27
Junior Member
 
Location: Germany

Join Date: Jan 2012
Posts: 3
Default

Quote:
Originally Posted by GenoMax View Post
You could use `repair.sh` to separate the singletons out afterwards.
Thanks for pointing me into this direction. Unfortunately, repair.sh did not produce well ordered files. Fortunately, bbsplitpairs.sh could be used instead of the reformat.sh/repair.sh combination and extracted the correct pairing reads as well as singletons into a separate file.
tolot27 is offline   Reply With Quote
Old 02-26-2019, 11:29 AM   #33
milw
Director NGS Services, Lucigen
 
Location: Madison WI USA

Join Date: Dec 2013
Posts: 12
Default I'm confused about sam/bam options

In version 37.52, the parameters under Sam and bam processing options are confusing to me
Sam and bam processing options:

mappedonly=f Toss unmapped reads.
unmappedonly=f Toss mapped reads.
pairedonly=f Toss reads that are not mapped as proper pairs.
unpairedonly=f Toss reads that are mapped as proper pairs.
primaryonly=f Toss secondary alignments. Set this to true for sam to fastq conversion.

if 'mappedonly' is false, shouldn't that mean to KEEP unmapped plus mapped reads?
Likewise, 'pairedonly' false (to me) means KEEP unpaired and paired

In the end, I want my bam to only contain paired reads, so I've been running it with 'pairedonly=t' , but reformat.sh says 'input is being processed as unpaired' for my bam file.
__________________
Scott Monsma
Sr Scientist at Lucigen

Last edited by milw; 02-26-2019 at 11:31 AM.
milw is offline   Reply With Quote
Old 09-25-2019, 01:45 AM   #34
Oomjah
Junior Member
 
Location: Scotland

Join Date: Sep 2019
Posts: 1
Default Could not find or load main class

Hi,

first time poster so my apologies for any horrid faux pas', and also for the thread necromancy!

I'm trying to convert fastq's to an unmapped SAM (ultimately to a cram to test space saving and to check no loss of data when it's reconverted back to fastq's again) and I saw a thread suggesting BBMAP. However I'm having the same issue as pepe84.

The command:
reformat.sh in=/opt/science/blah.fastq.gz out=/opt/science/blah.sam

results in:
"java -ea -Xm200m -cp /opt/science/BBMap/sh/current/ jgi.ReformatReads in=/opt/science/blah.fastq.gz out=/opt/science/blah.sam
Error: Could not find or load main class jgi.ReformatReads"

When I copy/paste the full java line quoted in the error but remove the space between "/current/" and "jgi.ReformatReads" I instead get:
"Error: Could not find or load main class in=.opt.science.blah.fastq.gz"

I've tried it with the fastq file both in and out of the BBMap directory to see if it would help, but got the same error.

Any advice would be gratefully accepted

Roy.

Quote:
Originally Posted by pepe84 View Post
here is the command:
java -cp C:\BBMap\current\jgi.ReformatReads in=“C:\BBMap\resources\SRRXXXXX.fastq” out1=EFB_R1.fq out2=EFB_R2.fq

And here is the error:
Error: Could not find or load main class in=C:\BBMap\resources\SRRXXXXX.fastq

Just an FYI I am using the command line on windows.

Thanks, I appreciate any help
Oomjah is offline   Reply With Quote
Old 09-26-2019, 03:55 AM   #35
quokka
Member
 
Location: oz

Join Date: Apr 2010
Posts: 12
Default

Hi,

I'm trying to use BBMap version 38.08 to retrieve fastq sequences from a bam file. However, I keep getting a problem where the quality output is merely: JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

Here's some lines from the bam file:

Code:
HISEQ:378:C7F64ANXX:3:1207:13039:83924	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	15	60	125M	=	644	754	GGGGGAGTGATAAAAATATATTTATTTCATCTAACTGATGAAATAACGTTTTTGCTCTTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGA	bbbbbfffffffffffffffffffffffffffffffffffffbffffffffef_ebffffffffffffffdfcefffffbfffffffbbfffffffdfefd_\ebOdefOWZW_bWefffdWce[	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
HISEQ:378:C7F64ANXX:3:1106:10647:86342	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	30	60	125M	=	669	764	ATATATTTATTTCATCTAACTGATGAAATAACGTTTTTGCTCTTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGTTTGAG	aabbbbffffffffffffffbbeffffffffffePaaebcfeefffffffeffYeffff\efPe]PePPPbc\bbPedP^PeaP]\dYbc]edcfOPOYd_bfeOcfOYOZ\\OdefffNObeOf	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
HISEQ:378:C7F64ANXX:3:1208:17933:95359	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	32	60	125M	=	620	713	ATATTTATTTCATCCAATTGATGAAATGATGTTTTTGCTCTTACAACTAATAGCTAAATACAGTAGAACTTGGATAATGCGTATGTGTTTGAGTTTTTAAAATATTGAGAGTGGAAGTTTGAGAA	aab_`dedbefe]ZPPP^PePdZbbPPY_cbffbfffdfPePPbPP[d][effdfffcebbffcbYPbP\P[PYdb\d]Pd\NdP]P]\eaP[aeePec_OYYOOOYea\O]_O_^dW]edcfef	NM:i:11	MD:Z:14T2C9A1C23T8A0C11G3G23G10G10	MC:Z:125M	AS:i:70	XS:i:0
HISEQ:378:C7F64ANXX:3:2305:17850:4846	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	52	60	125M	=	625	690	ATGAAATGATGTTTTTGCTCTTACAACTAATAGCTAAATACAGTAGAACTTGGATAATGCGTATGTGTTTGAGTTTTTAAAATATTGAGAGTGGAAGTTTGAGAATGCATCAAACCTTGGGAAGG	abbbbffffffffffffffffffffffffffffeffffffffffffeffffff]db\aeffffffffffffffP]ecaeffff]efffeeff_fffffffffffeffffffffffffffffffef	NM:i:9	MD:Z:7A1C23T8A0C11G3G23G10G30	MC:Z:117M8S	AS:i:80	XS:i:0
HISEQ:378:C7F64ANXX:3:2205:15096:32122	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	59	60	125M	=	675	741	AACGTTTTTGCTCTTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGGTTGAGGATGCATCAAACCTTGGGAAGGAATAAGT	`aa_`ffaefP^Z\bPdP^_cebPPYbadfffbfbecac_a_Pef]P\Y[PbedPP[e\ed_facYPefff_efePbYYbP]\PP[deO\NN]e[aOOZbOOYaeef]bcb_OeOWb]ZWbOObO	NM:i:2	MD:Z:90T5A28	MC:Z:125M	AS:i:115	XS:i:0
HISEQ:378:C7F64ANXX:3:1307:17567:99979	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	68	60	125M	=	718	775	GCTCTTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGTTTGAGAATGCATCAAACCTTGGGAAGGAATAAGTCTTTTGGCC	ababbfffffffffffffffffffffffffffffffffffcffdfeffff]efffffefcffffffffefffffffecfffaefffffffffffffffffffeffffffffffffffb]e]fa]e	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
HISEQ:378:C7F64ANXX:3:2211:20485:88833	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	68	60	125M	=	654	711	GCTCTTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGTTTGAGAATGCATCAAACCTTGGGAAGGAATAAGTCTTTTGGCC	aabaaecfffffffffffffffffffffffffffffdefffffefffffffdeffffdefffffffffdffffefffffffefffffffff]cfdfdffffffffffcffffffffbeffffeff	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
HISEQ:378:C7F64ANXX:3:1212:7300:28109	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	71	60	125M	=	636	690	CTTACAACTAATAGCTAAATACAGTAGAACTTGGATAATGCGTATGTGTTTGAGTTTTTAAAATATTGAGAGTGGAAGTTTGAGAATGCATCAAACCTTGGGAAGGAATAAGTCTTTTGGCCTTC	bbbbbfffffffffffffffffffffffffffffffffffffaffffeefffff^efffffffffcffPeff]efffffffffffefffffffffffffffdfffffdfffff]bfdffffffff	NM:i:7	MD:Z:14T8A0C11G3G23G10G49	MC:Z:125M	AS:i:90	XS:i:0
HISEQ:378:C7F64ANXX:3:2303:16430:40702	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	72	60	125M	=	694	747	TTACAACTAATAGTTAAATACAACAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGTTTGAGAATGCATCAAACCTTGGGAAGGAATAAGTCTTTTGGCCTTCC	abbbaffffffffffffdffffffeffffffffffeefffeffffefffefffcffffffffffdffffff_fffffaefffffff]edfffffffff]fffffffffdffcefffffff]ae_b	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
HISEQ:378:C7F64ANXX:3:2116:16496:33002	97	smaller_kp_promoter_region_upstream_of_atg_with_chloroplast_insertion_removed_1814_upstream_of_insertion_and_1089_downstream_upstream__5_prime_end_adjacent_to_a_stretch_of_n_residues	95	60	125M	=	722	752	CAGAACTTGGATGATGGGTATGTGTTTGAGTTTTTAAAATGTTGAGAGTGGGAGTTTGAGAATGCATCAAACCTTGGGAAGGAATAAGTCTTTTGGCCTTCCAAAACTATATAGATAGATAGAGC	bbbbbffffffffffffdffffeeffffffdffffffeffffffffffdfffff]ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff	NM:i:0	MD:Z:125	MC:Z:125M	AS:i:125	XS:i:0
Here's the command and STDERR (NB in this case I was using qin=64 qout=33 for troubleshooting but I get the same result without these flags):

Code:
/home/xub/host/opt/bbmap/bbmap/reformat.sh qin=64 qout=33 requiredbits=16 overwrite=t in=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.1.bam out=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.reverse.1.fq.gz
java -ea -Xmx200m -cp /home/xub/host/opt/bbmap/bbmap/current/ jgi.ReformatReads qin=64 qout=33 requiredbits=16 overwrite=t in=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.1.bam out=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.reverse.1.fq.gz
Executing jgi.ReformatReads [qin=64, qout=33, requiredbits=16, overwrite=t, in=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.1.bam, out=/home/xub/host/opt/findMatesAndRepair/output/150901_80_small/150901_80_small.bothEndsMapped.reverse.1.fq.gz]

Could not find sambamba.
Found samtools 1.8
Input is being processed as unpaired
Input:                  	464 reads          	58000 bases
Output:                 	230 reads (49.57%) 	28750 bases (49.57%)

Time:                         	0.634 seconds.
Reads Processed:         464 	0.73k reads/sec
Bases Processed:       58000 	0.09m bases/sec


Here's some of the output:

Code:
@HISEQ:378:C7F64ANXX:3:2205:16922:87749
CAAATGACAACCTAAATTGTAAACTGTTTTTTTAAAATCTACTAACCCAAACTGAATCATTTTATAAACCAAATCAAACTATAATTTTTAAATGGTTTGGTCCGATTTTATAATTTGAGCCTATT
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@HISEQ:378:C7F64ANXX:3:1210:20568:23121
AAATTTATCCAAATGACAACCTAAATTGTAAACTGTTTTTTTAAAATCTACTAACCCAAACTGAATCATTTTATAAACCAAATCAAACTATAATTTTTAAATGGTTTGGTCCGATTTTATAATTT
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@HISEQ:378:C7F64ANXX:3:2212:11893:40357
GGTTTATGGTTTGACTTGGTTTGAAATTTATCCAAATGACAACCTAAATTGTAAACTGTTTTTTTAAAATCTACTAACCCAAACTGAATCATTTTATAAACCAAATCAAACTATAATTTTTAAAT
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@HISEQ:378:C7F64ANXX:3:2210:7117:7877
GGTTTGACTTGGTTTGAAATTTATCCAAATGACAACCTAAATTGTAAACTGTTTTTTTAAAATCTACTAACCCAAACTGAATCATTTTATAAACCAAATCAAACTATAATTTTTAAATGGTTTGG
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

Thanks for any advice.

Cheers.
quokka is offline   Reply With Quote
Old 09-26-2019, 04:18 AM   #36
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,080
Default

Did you move any of the bbmap folder contents after you downloaded and uncompressed bbmap code?

Make sure the top level directory with BBMap is in your $PATH. Something like
Code:
export PATH=$PATH:/opt/science/BBMap
would work.


Quote:
Originally Posted by Oomjah View Post
Hi,

first time poster so my apologies for any horrid faux pas', and also for the thread necromancy!

I'm trying to convert fastq's to an unmapped SAM (ultimately to a cram to test space saving and to check no loss of data when it's reconverted back to fastq's again) and I saw a thread suggesting BBMAP. However I'm having the same issue as pepe84.

The command:
reformat.sh in=/opt/science/blah.fastq.gz out=/opt/science/blah.sam

results in:
"java -ea -Xm200m -cp /opt/science/BBMap/sh/current/ jgi.ReformatReads in=/opt/science/blah.fastq.gz out=/opt/science/blah.sam
Error: Could not find or load main class jgi.ReformatReads"

When I copy/paste the full java line quoted in the error but remove the space between "/current/" and "jgi.ReformatReads" I instead get:
"Error: Could not find or load main class in=.opt.science.blah.fastq.gz"

I've tried it with the fastq file both in and out of the BBMap directory to see if it would help, but got the same error.

Any advice would be gratefully accepted

Roy.
GenoMax is offline   Reply With Quote
Old 06-16-2020, 12:12 PM   #37
pieterjanvc
Junior Member
 
Location: USA

Join Date: Jun 2020
Posts: 1
Default Inaccurate sampling rate output - reformat.sh

Hello,

I have been using the reformat.sh script for a while (nice stuff!) but am running into an issue.

I need to get a specific number of reads from a file and am using the `--samplerate` option to do that. For example, if a file has 100 reads, and I need 10, I set the sample rate to 0.1. Unfortunately, it seems that for large files with very specific sample rates, the actual number of reads returned is not the product of the total reads and the sample rate. Here is an example output:

Code:
Executing jgi.ReformatReads [samplerate=0.5582187961,
 in1=SRR2976833.fastq.gz, in2=, out=tempFile1.fastq.gz]

Input is being processed as unpaired
Input:                          509774 reads            122293939 bases
Processed:                      284893 reads            68330214 bases
Output:                         284893 reads (55.89%)   68330214 bases (55.87%)

Time:                           2.295 seconds.
Reads Processed:        284k    124.12k reads/sec
Bases Processed:      68330k    29.77m bases/sec
As you can see, the sample rate is set at 0.5582187961. Using the total number of reads, that would be 509774 * 0.5582187961 = 284565 (rounded down) reads once finished. However, the total read count is 284893, with the percentage being 55.89% instead of 55.82 as set.

Please let me know why this is happening and if there is a solution.

Thanks!
PJ
pieterjanvc is offline   Reply With Quote
Old 06-17-2020, 09:50 AM   #38
Sadi47
Junior Member
 
Location: lahore

Join Date: Apr 2020
Posts: 3
Default

Quote:
Originally Posted by Brian Bushnell View Post
Reformat is a member of the BBMap/BBTools package. It is a multipurpose tool designed for converting reads or other nucleotide data between different formats. It supports, and can inter-convert:

fastq
fasta
fasta+qual
sam
scarf (an old Illumina format)
bam (if samtools is installed)
gzip
zip
ascii-33 (sanger)
ascii-64 (old Illumina)
paired files
interleaved files

It is multithreaded and can process data at over 500 megabytes per second, and can accept streams from standard in and write to standard out, allowing it to be easily dropped into the middle of a pipeline for format conversion. Reformat autodetects formats based on file extensions and content, making it very easy to use; and the autodetection can be overridden, allowing flexibility for people who don't like to follow naming conventions, or out-of-spec fastq files with qualities values like -17 or 120.

The program has been gradually expanded, and can now perform various other functions. None of these will break pairing, if the input is paired.

Quality trimming (either or both ends)
Quality filtering
Fixed-length trimming
Generation of histograms (base composition, quality, etc)
Subsampling (to a fraction of input reads, or an exact number of reads or bases)
Changing fasta line-wrapping length
Reverse-complementing (all reads or only read 2)
Adding /1 and /2 suffix to read names
GC-content filtering
Length-filtering
Testing for corrupted interleaved files

Reformat is compatible with any platform that supports Java 1.7 or higher. It also has a bash shellscript for simpler invocation. Typical usage examples:

Reformat fastq into fasta:
reformat.sh in=x.fq out=y.fa

Interleave paired reads:
reformat.sh in1=x1.fq in2=x2.fq out=y.fq

Note - you can actually use a shortcut if paired read files have the same name with a 1 and a 2. This is equivalent to the above command:
reformat.sh in=x#.fq out=y.fq

De-interleave reads:
reformat.sh in=x.fq out1=y1.fq out2=y2.fq

Verify that interleaving appears correct, assuming Illumina namimg conventions:
reformat.sh in=x.fq vint

Convert ASCII-33 to ASCII-64:
reformat.sh in=x.fq out=y.fq qin=33 qout=64

Quality-trim paired reads to Q10 on the left and right ends and discard reads shorter than 50bp after trimming:
reformat.sh in1=x1.fq in2=x2.fq out1=y1.fq out2=y2.fq outsingle=singletons.fq qtrim=rl trimq=10 minlength=50

Subsample 10% of the first 20000 pairs in an interleaved file:
reformat.sh in=x.fq out=y.fq reads=20000 samplerate=0.1 int=t
(in this case "int=t" overrides interleaving autodetection, to ensure reads are treated as pairs)

Pipe in a gzipped sam file and pipe out fasta:
reformat.sh in=stdin.sam.gz out=stdout.fa

Reverse-complement reads:
reformat.sh in=x.fq out=y.fq rcomp

For reformatting a file with very long sequences, Reformat will need more memory; just add the additional flag "-Xmx2g". For example, to change the line-wrapping length on the human genome (which has individual sequences over 200Mbp long) to 70 characters:
reformat.sh -Xmx2g in=HG19.fa.gz out=HG19_wrapped.fa.gz fastawrap=70

For additional functions, please run the shellscript with no arguments, or just read it with a text editor. If you have any questions, please post them in this thread.

For people using a non-bash terminal, you may need to type "bash reformat.sh" instead of just "reformat.sh".
For users of Windows or other platforms that do not support bash shellscripts, replace "reformat.sh" with "java -ea -Xmx200m /path/to/bbmap/current/ jgi.ReformatReads"
for example,
java -ea -Xmx200m C:\bbmap\current\ jgi.ReformatReads in=x.fq out=y.fa

Reformat can be downloaded with BBTools here:
https://sourceforge.net/projects/bbmap/

Its really helpful information thanks.
Sadi47 is offline   Reply With Quote
Reply

Tags
ascii33, ascii64, bbduk, bbmap, bbtools, fasta, fastq, interleavei33, quality trim, reformat, scarf, subsample

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:37 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO