![]() |
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
RAPID Libraries adaptor+key sequences | dottomarco | 454 Pyrosequencing | 15 | 01-14-2021 12:56 AM |
Adaptor sequences RNA seq -remove? | sebastion | RNA Sequencing | 1 | 07-31-2012 11:00 AM |
P1 adaptor vs. Multiplex P1 adaptor | hfaoro | SOLiD | 0 | 03-26-2012 06:54 AM |
Make a complete genome sequences from Illumina data | nhbach | Illumina/Solexa | 2 | 08-30-2011 06:58 PM |
Problems with small RNA adaptor sequences | chris | Bioinformatics | 0 | 09-16-2010 09:04 AM |
![]() |
|
Thread Tools |
![]() |
#1 |
Junior Member
Location: Denmark Join Date: Mar 2011
Posts: 4
|
![]()
Hello everyone,
I am producing Ion Torrent sequencing libraries both using the ligation based library kit and the ampliseq strategy. The only adaptor sequences I can find from Lifetech are the ones involved in ampliseq: Forward primer (Primer A-key): 5’-CCATCTCATCCCTGCGTGTCTCCGACTCAG-template-specific-sequence-3’ Reverse primer (Primer P1-key): 5’-CCTCTCTATGGGCAGTCGGTGAT-template-specific-sequence-3’ For quantitation purposes I use the Taqman based qPCR kit. This is however only possible with the ligated libraries. On this basis I assume the double stranded oligos used for ligation contains a longer sequence, than the one generated in the ampliseq PCR. Does anyone have this sequence of the ligation adaptors? I know this may well, for some obscure reason, be one of Lifetechs little secrets and that I may have to go through the trouble of cloning and sequencing the adaptors myself. |
![]() |
![]() |
![]() |
#2 |
Member
Location: Russia Join Date: Dec 2007
Posts: 88
|
![]()
Ion A Adapter (non-barcoded)
....5'—CCATCTCATCCCTGCGTGTCTCCGACTCAG–3' 3'—T*T*GGTAGAGTAGGGACGCACAGAGGCTGAGTC-5' Ion P1 Adapter ....5'—CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT–3' 3'—T*T*GGTGATGCGGAGGCGAAAGGAGAGATACCCGTCAGCCACTA-5' http://seqanswers.com/forums/attachm...1&d=1343464421 |
![]() |
![]() |
![]() |
#3 |
Junior Member
Location: Denmark Join Date: Mar 2011
Posts: 4
|
![]()
Exactly what I was looking for! Thank you very much genseq!
|
![]() |
![]() |
![]() |
#4 | |
Member
Location: Guilford, CT and S.F., CA Join Date: Jan 2010
Posts: 64
|
![]()
Hi Apex,
The sequences of the fragment library adaptors can be found in Appendix D (pp. 45) of the current Ion Xpress™ Plus gDNA Fragment Library Preparation User Guide, as available on the Ion Community. Ion AmpliSeq™ Custom Panels may be designed using the Ion AmpliSeq™ Designer website. Quote:
|
|
![]() |
![]() |
![]() |
#5 |
Junior Member
Location: Germany Join Date: Aug 2014
Posts: 2
|
![]()
Hi,
I'm new to Life Tech semi conductor Sequencing and only have MiSeq experience. We were offered a demo run of the Ion S5 and I would like to produce the library beforehand with our custom protocol. Can anyone tell me if the Ion torrent adaptors are the same for the Ion S5? Fwd: CCATCTCATCCCTGCGTGTCTCCGACTCAG Rev: CCTCTCTATGGGCAGTCGGTGAT cheers, JoF |
![]() |
![]() |
![]() |
Tags |
adaptor sequence |
Thread Tools | |
|
|