SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Extract node information from de Bruijn graph holmrenser Bioinformatics 0 07-17-2013 07:35 AM
Tutorials on de Bruijn graph samanta General 2 03-27-2013 07:34 AM
Tutorials on de Bruijn graph samanta Bioinformatics 0 03-26-2013 06:52 PM
Need explication about how work the LastGraph file of Velvet Wizard50 Bioinformatics 4 09-13-2012 08:13 PM

Reply
 
Thread Tools
Old 07-12-2017, 05:11 AM   #1
Splinter479
Junior Member
 
Location: Berlin, Germany

Join Date: Aug 2012
Posts: 6
Default Reconstructing a de Bruijn Graph from Velvet's LastGraph

Hi,

I was wondering if someone can explain/ give hints to me about how to regain a de Bruijn Graph from Velvet's LastGraph representation of nodes and arcs?

I created an example with hashsize (k)=7 and told velvetg to "keep all data" by setting cov_cutoff=1 min_contig_lgth=1:

Code:
>SEQUENCE_0
TTTTTTCATGCATGCTAGCGTGTGTGTGT
>SEQUENCE_1
GTGTGTGTGTTAGCTGCAGTATGCGGAAC
>SEQUENCE_2
ACACACACACATCGATTGTTATGCGGAAC
>SEQUENCE_3
TATGCGGAACGCATTGCTAACTCGGGGGG
results in

Code:
5	4	7	1
NODE	1	12	13	13	0	0
GCTAGCATGCAT
GCTAGCGTGTGT
NODE	2	1	6	6	0	0
G
C
NODE	3	1	7	7	0	0
T
A
NODE	4	15	15	15	0	0
TAGCTGCAGTATGCG
CTGCAGCTAACACAC
NODE	5	14	14	14	0	0
TCGATTGTTATGCG
ACAATCGATGTGTG
ARC	1	-1	2
ARC	-1	2	1
ARC	2	3	6
ARC	-2	-3	4
ARC	3	4	1
ARC	-3	5	1
I don't get exactly HOW to read out the sequence from the traversal of the nodes, e.g. (1) --> (-1), (-1) --> (2) and so on.
Once I know how to read the sequence I could rebuild a simple de Bruijn Graph from it. Or is there maybe some simpler (back-)transformation from LastGraph to de Bruijn Graph?

The (very old) manual page of Velvet is not helping too much

Any help highly appreciated.

Thanks!


------------------------------
EDIT
------------------------------

Another example:
Let's take a sequence s=ACTGGACTGAA
As I recall this results in the dBG of s:
Code:
ACT --> CTG --> TGG --> GGA --> GAC --> (ACT...)
         | 
         |--> TGA --> GAA
Velvet's result is (k=3, velvetg cov_cutoff=1 min_contig_lgth=1):
1 1 3 1
NODE 1 5 7 7 0 0
TGGAC
CCAGT
ARC 1 1 1

This means I would be able to recover:
Code:
(Node 1 upper seq.)              TGGAC
                                 |||    --> ACTGGAC  (and an arbitrary amount of concatenations of this seq. since ARC (1) --> (1) )
(Node 1 lower seq. rev.comp.)  ACTGG
BUT, it seems to me that Velvet is missing the entire alternative path "TGAA" of the dBG of s.
I would have expected another node and an additional arc to find that sequence.

Am I right until here? Do I miss some/ should I change some parameter?

Last edited by Splinter479; 07-12-2017 at 11:26 PM.
Splinter479 is offline   Reply With Quote
Reply

Tags
de bruijn graph, lastgraph, velvet

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:50 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO