SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK to discover Single Nucleotide Variation in mature miRNA from miRNA-Seq Bioinfo83 Bioinformatics 0 01-31-2012 04:11 AM
miRNA-Seq with samples that have different % miRNA to Total RNA... DrDTonge Bioinformatics 0 01-12-2012 11:20 PM
miRNA-seq HiSeq2000 expression profiling problem mirandaseq Bioinformatics 0 06-09-2011 07:43 AM
Expression analysis on Human Body Map 2.0 (HiSeq2000) johannes.helmuth RNA Sequencing 0 05-13-2011 12:43 AM
PubMed: Expression profiling of microRNAs by deep sequencing. Newsbot! Literature Watch 0 04-01-2009 05:01 AM

Reply
 
Thread Tools
Old 06-10-2011, 05:57 AM   #1
mirandaseq
Junior Member
 
Location: USA

Join Date: Jun 2011
Posts: 4
Default miRNA-seq HiSeq2000 expression profiling problem

I have a problem doing gene expression profiling of microRNAs. I have data of a miRNA-seq experiment on a HiSeq 2000 from the same rat tissue at 5 different time points. After adaptor trimming and aligning, the expression level of a given miRNA (from control, i.e. non-experimental tissue) is fluctuating across the different time points whereas one would expect the same expression level for all time points.
Attached is a plot showing the gene expression of one miRNA on a time course scale.
The following command was used to trim the adaptors:
Code:
./fastx_clipper -i /raw.fastq/miRNA.fastq -o /trimmed.adapter/miRNA.trimmed.adapter.fastq -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -l 15 -M 20 -c
This command was used for alignment in bowtie:
Code:
bowtie -k 2 -v 0 -S -p 16 -q --solexa1.3-quals /ref/ref.genome /trimmed.adapter/miRNA.trimmed.adapter.fastq /align/miRNA.trimmed.adapter.sam
We tried to align the trimmed reads against known miRNAs (from mirBase) and against the genome and had nearly the same results. We also filtered out reads that are from other non-coding RNA classes (such as rRNA, tRNA, snRNA etc). Also, discarding reads shorter than 15 bp and longer than 30 bp yielded the same results, that is variable expression level for a given miRNA in control animals.

Any help is appreciated!
Attached Files
File Type: pdf seqAnswer.miRNA.pdf (15.8 KB, 49 views)
mirandaseq is offline   Reply With Quote
Old 06-16-2011, 05:35 AM   #2
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Default

how do you calculate the RPKMs ?
volks is offline   Reply With Quote
Old 06-16-2011, 05:45 AM   #3
mirandaseq
Junior Member
 
Location: USA

Join Date: Jun 2011
Posts: 4
Default

read count/(total read count * miRNA length) * 1E6
mirandaseq is offline   Reply With Quote
Old 06-16-2011, 05:50 AM   #4
NicoBxl
not just another member
 
Location: Belgium

Join Date: Aug 2010
Posts: 264
Default

So what is the question ?
NicoBxl is offline   Reply With Quote
Old 06-16-2011, 12:47 PM   #5
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Default

Quote:
Originally Posted by mirandaseq View Post
read count/(total read count * miRNA length) * 1E6
total read count means reads mapped to miRNAs?
volks is offline   Reply With Quote
Old 06-16-2011, 03:05 PM   #6
mirandaseq
Junior Member
 
Location: USA

Join Date: Jun 2011
Posts: 4
Default

Yes, this is what it means
mirandaseq is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:16 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO