
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
bwa perfect match only guil Bioinformatics 4 08-30-2013 09:18 AM
Bowtie: Ultrafast and memory-efficient alignment of short reads to the human genome Ben Langmead Literature Watch 2 03-04-2013 02:06 AM
Bowtie and Tophat in disagreement with alignment NM_010117 Bioinformatics 4 12-20-2010 12:21 PM
perfect alignment match NicoBxl Bioinformatics 3 10-07-2010 04:28 AM
Blat vs bowtie/tophat on Rnaseq data oliviera Bioinformatics 10 04-23-2010 10:07 AM

Thread Tools
Old 03-09-2009, 08:12 AM   #1
Location: UK

Join Date: Feb 2009
Posts: 33
Default Perfect match disagreement between bowtie and BLAT on human genome


I am currently testing a number of aligners with application to miRNA sequenceing and have come across a curious problem with bowtie. I run bowtie with the following options so should get all the perfect matches:
./bowtie -p 4 --solexa-quals --best -k 100  -t h_sapiens_asm ../GDB1.fastq
The index file is the human genome as supplied by the makers of bowtie.

For the sequence "TGGGAATACCGGGTGCTGTAGGCTTT" I get two hits one on chromosome 12 and the other on the X. When I blat this sequence I get 22 hits (chr1 * 16, 12*2, X*2, 17, 19).

Does anyone know why there is a difference?

I also applied the same dataset to novoalign,
./novoalign -rAll -f ../GDB1.fastq -d hsapiens >
, and get 23 perfect matches, with an extra chromosome 1 match.

I am very confused as to why there is so many differences and would welcome any help in this area.

danielsbrewer is offline   Reply With Quote
Old 03-09-2009, 10:24 AM   #2
Ben Langmead
Senior Member
Location: Baltimore, MD

Join Date: Sep 2008
Posts: 200

Hi there,

I can't reproduce this. When I run "./bowtie -c --solexa-quals --best -k 100 h_sapiens_asm TGGGAATACCGGGTGCTGTAGGCTTT", I get 23 hits; presumably the same ones as novoalign:

sycamore:~/research/bowtie $ ./bowtie -c --solexa-quals --best -k 100 /fs/szasmg/langmead/ebwts/h_sapiens_asm TGGGAATACCGGGTGCTGTAGGCTTT
Reported 23 alignments to 1 output stream(s)

Is there another example where Bowtie does not produce the expected output that I can try?

Ben Langmead is offline   Reply With Quote
Old 03-10-2009, 01:59 AM   #3
Location: UK

Join Date: Feb 2009
Posts: 33

I think I have worked out the problem. Novoalign outputs the source read sequence no matter what strand it is on whereas bowtie always takes the sequence on the same strand, no matter what strand the match was to. So I was just filtering on "TGGGAATACCGGGTGCTGTAGGCTTT" whereas the other hits that came on the reverse strand were reported under "AAAGCCTACAGCACCCGGTATTCCCA".

Sorry for the confusion.
danielsbrewer is offline   Reply With Quote
Old 03-10-2009, 09:10 PM   #4
Location: Houston, TX

Join Date: Mar 2009
Posts: 27

When I enter your sequence in ISAS I get 23 perfect matches. Below is a transcript of an interactive session.

Enter next command, or type "?" (and ENTER) for list of commands.

For each sequence, the search will stop if 30 hits are found.
Allocated buffer for 58.4 million sequences (0.0 sec.)

Enter next command, or type "?" (and ENTER) for list of commands.


23 matches found in 9.0 micro seconds.

Match no. 1: Reverse Chr. 1 Positions 226812661..226812636, 0 Mismatches

0 substitutions

Match no. 2: Reverse Chr. 1 Positions 226814902..226814877, 0 Mismatches

0 substitutions

Match no. 3: Reverse Chr. 1 Positions 226817143..226817118, 0 Mismatches

0 substitutions

Match no. 4: Reverse Chr. 1 Positions 226819384..226819359, 0 Mismatches

0 substitutions

Match no. 5: Reverse Chr. 1 Positions 226821625..226821600, 0 Mismatches

0 substitutions

Match no. 6: Reverse Chr. 1 Positions 226823840..226823815, 0 Mismatches

0 substitutions

Match no. 7: Reverse Chr. 1 Positions 226826060..226826035, 0 Mismatches

0 substitutions

Match no. 8: Reverse Chr. 1 Positions 226828302..226828277, 0 Mismatches

0 substitutions

Match no. 9: Reverse Chr. 1 Positions 226830541..226830516, 0 Mismatches

0 substitutions

Match no. 10: Reverse Chr. 1 Positions 226832783..226832758, 0 Mismatches

0 substitutions

Match no. 11: Reverse Chr. 1 Positions 226835024..226834999, 0 Mismatches

0 substitutions

Match no. 12: Reverse Chr. 1 Positions 226837264..226837239, 0 Mismatches

0 substitutions

Match no. 13: Reverse Chr. 1 Positions 226839489..226839464, 0 Mismatches

0 substitutions

Match no. 14: Reverse Chr. 1 Positions 226841730..226841705, 0 Mismatches

0 substitutions

Match no. 15: Reverse Chr. 1 Positions 226843961..226843936, 0 Mismatches

0 substitutions

Match no. 16: Reverse Chr. 1 Positions 226846202..226846177, 0 Mismatches

0 substitutions

Match no. 17: Reverse Chr. 1 Positions 226848433..226848408, 0 Mismatches

0 substitutions

Match no. 18: Reverse Chr. 7 Positions 139733073..139733048, 0 Mismatches

0 substitutions

Match no. 19: Forward Chr. 12 Positions 34249996..34250021, 0 Mismatches

0 substitutions

Match no. 20: Reverse Chr. 12 Positions 36841558..36841533, 0 Mismatches

0 substitutions

Match no. 21: Reverse Chr. 19 Positions 21087797..21087772, 0 Mismatches

0 substitutions

Match no. 22: Reverse Chr. 23 Positions 28910913..28910888, 0 Mismatches

0 substitutions

Match no. 23: Forward Chr. 23 Positions 68809143..68809168, 0 Mismatches

0 substitutions
BioWizard is offline   Reply With Quote

blat, bowtie, disagreement, novoalign

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 11:43 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO