SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
TruSeq Small RNA cascoamarillo Illumina/Solexa 22 08-07-2014 10:37 AM
TruSeq small RNA NicoBxl Illumina/Solexa 3 01-16-2012 04:08 AM
TruSeq small RNA for directional sequencing ambmor RNA Sequencing 3 09-15-2011 12:11 PM
small RNA Truseq library sequencing primers deepakpatilp Illumina/Solexa 0 08-26-2011 01:22 AM
How small is too small for TruSeq RNA? eab Sample Prep / Library Generation 8 06-02-2011 04:21 PM

Reply
 
Thread Tools
Old 08-11-2011, 01:13 AM   #1
Palgrave
Member
 
Location: norway

Join Date: Aug 2011
Posts: 73
Default filtering small RNA TruSeq reads

I just got smallRNA-seq reads prepared by the TruSeq small RNA protocol from Illumina with index 1-7 and I am wondering what filtration is necessary?

I have started by removing the revers complement of the following PCR primer:

RNA PCR Primer, Index 1 (RPI1)
CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA


Do I need to remove anything in addition, like any of these:

RNA 5 Adapter (RA5), part # 15013205
5 GUUCAGAGUUCUACAGUCCGACGAUC

RNA 3 Adapter (RA3), part # 15013207
5 TGGAATTCTCGGGTGCCAAGG
Palgrave is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:51 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO