SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
paired-end vs. mate-pair lre1234 Bioinformatics 8 04-05-2013 05:25 AM
scaffolding GAII paired-end library with Hiseq mate-pairs stevebaeyen Bioinformatics 17 02-27-2013 01:45 AM
Tophat paired end alignment help: comma or blank to separate two pairs? mediator Bioinformatics 3 01-31-2012 08:44 AM
Mate pairs contaminated with paired ends - impact on assembly? reithme Bioinformatics 2 12-13-2009 11:35 PM
Compute paired-end distance distribution? krobison Bioinformatics 11 11-12-2009 08:30 AM

Reply
 
Thread Tools
Old 06-14-2012, 10:35 AM   #1
prussiap
Junior Member
 
Location: 94608

Join Date: May 2012
Posts: 6
Default Sorting Paired-end files, and automating Mean Inner Distance between Mate Pairs

Hi Guys,
I was following this tutorial and they provided a bunch of paired-end reads.
Forward and Reverse ones.

Automated Goal: Create a script that takes single read, paired-end and mate-pair ends and does a sanity check of a few values:
  1. 1. Determines if these are indeed the types of files that are input
  2. 2. Checks the Paired-end/mate-paired files to see if they are matched/sorted annotated, if not cleans it up.
  3. 3. Determines the size of the insert and inner distance to compare with the supposed experimental bio-analyzer data
  4. 4. If all the above is ok, take a sampling of the large data sets, and do the above QC with BWA/Bowtie.

So I ran BWA and noticed the INED values all over the place. Went back and realized that the files neither have /1 /2 attached to them nor are they sorted and ordered. I'm assuming that's my first problem ?

Is that my correct assumption:

So to sort and append the /1 /2 files I was going to use something like this.

For my sampling I was gonna use this:

For the alignment, I could use BWA, Velvet/QUALMAP/HTSEQ

Ideally I can use python for this (as i'm more comfortable with it). Ok any thoughts and ideas on this from anybody ? Am I on the right track. Am I indeed correct about the non-sorted fastq files being the issues? have you done similar things with your data ?

I was gonna supply the first two reads as an example:
Forward Fastq:
@HWI-ST534_129:2:27:10054:113252:CGATGT
GCGGAGCCGGGTGACTGGCGAGCCGGAACATCAGGCGCCGCCGCAGAGAA
+
EEEECBEED>EEGEF<DA:A<CDDD?5DAAACA=C?D<@CGFEADEDDBE
@HWI-ST534_129:2:62:5677:145482:CGATGT
CGGAACATCAGGCGCCGCCGCAGAGAAGAACTATGGAGGAGCCCTCTGAG
+
HBGFHHHDFGHHGFHHGHFFFHHFHEFE<GEAAABHEDF@EEFFDFAEED

Reverse FastQ:
@HWI-ST534_129:2:24:20503:16510:CGATGT
CTGAGAGCCGGGGAAGCCGGCGGAGCCGGGGGACTGGCGAGCCGGAACAT
+
HHHHHHHHHHEFDDGDDFBFGG>7D4<9;<&?:;<DC>CCDD@?=?A###
@HWI-ST534_129:2:42:2118:9580:CGATGT
GGCGGAGCCGGGTGACTGGCGAGCCGGAACATCAGGCGCCGCCGCAGAGA
+
GEECGGGBGIDF6FFFFEF=IDEFBEE8E8E?EEB@6=9B##########
prussiap is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:16 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO