SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
When to include Cufflinks/Cuffdiff -u and -b flags? KAP Bioinformatics 0 08-15-2011 02:37 PM
Filtering SOLiD reads before mapping?? Conflicting advice hlwright SOLiD 5 06-27-2011 05:10 AM
Confused with sam flags anle Bioinformatics 0 05-24-2011 10:55 PM
Sam flags for bwa-aligned paired end reads with identical + / - strand coordinates spark Bioinformatics 0 03-09-2011 04:00 AM
SAM flags for bowtie-Tophat dnusol Bioinformatics 5 03-02-2011 10:36 PM

Reply
 
Thread Tools
Old 09-10-2012, 03:47 AM   #1
ekageyama
Junior Member
 
Location: Tuebingen

Join Date: Sep 2012
Posts: 3
Default BWA conflicting flags

Hi!
I have a problem, and haven't found a solution for it, maybe someone in here might be able to help me. I have some hiseq reads and was mapping them against a genome with BWA. After the mapping I looked at the SAM file and found this

504740071024319674 77 * 0 0 * * 0 0 AGATGGAAAACAAAAAAAACTCATAGGGACTTCGTCCTCTCATAAAAAACTTGGGGAAACCATAATAAGCTTGTGTAGGGTTCTTGGAGTCCAATATGACA IIIIIIIIIIIIIIIIIIIIIIIHIHHIIHIIIIHIIHIIIHIIHIIHHFIIIHHIGHHGHHHHHHHGHGGGHDHBEEEE@EEFECBCEBD@DDEEEED=B
504740071024319674 181 scaffold_3|24390584|24400594 2165 0 * = 2165 0 AGCCATAATAAGCTTGTGTAGGGTTCTTGGAGTCCAATATGAGAAGATTGGTGTGTATGACTGAGTATAAGAAAGGGAAATGCAACCCGGATCCTGATTGC ##?<BBABBBABDADDDEDEGECBBB8GGGGCBEDEGEHBGHGGHHHCGHHGHHIHIIIHIFIIIIIIIGGIHHIIIIIIHIIHHIIIIIIHHIIIIIIII

So, the second column of each line (the FLAG field) seem to be conflicting, 77 1+4+8+84 which is both reads unmapped, the second one is 181 1+4+16+32+128 whcih means 1 red is unmapped and one isn't. Anyone have an idea of that is happening here?
Thank you!
ekageyama is offline   Reply With Quote
Reply

Tags
allignment, bwa, flag, read, sequencing

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:58 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO