SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
BWA Mem Not Using All Reads TKTKTK Bioinformatics 21 09-11-2014 07:57 AM
BWA -mem FrankiB RNA Sequencing 2 02-07-2014 08:31 AM
BWA MEM question CHObot Bioinformatics 5 08-08-2013 03:04 AM
bwa mem segfault; bwa bwasw breaks MarkDuplicates ElenaN Bioinformatics 2 06-30-2013 10:23 PM
bwa mem -R option dakin Bioinformatics 2 05-02-2013 07:42 AM

Reply
 
Thread Tools
Old 12-15-2014, 11:05 PM   #1
demienx
Junior Member
 
Location: China

Join Date: Oct 2014
Posts: 4
Question nothing aligned using bwa mem

Hi there.
I am using bwa to align human RNA-seq reads to rRNA database to exclude rRNA pollution. I tried both bwa backtrack and mem, and very strangely only backtrack could map some of my reads to rRNA reference, while mem mapped NONE. I think there must be something wrong but I just cannot figure out what. My command is listed below:
backtrack:
bwa aln -l 20 -f se-reads.sai rRNA.fa se-reads.gz && bwa samse -f se-read-backtrack.sam rRNA.fa se-reads.sai se-reads.gz
mem:
bwa mem -k 17 rRNA.fa se-reads.gz > se-read-mem.sam

My reads were single-ended and the length was 28 bp. The input reads were fastq gzip files.

And I'd like to post a same read for example that was mapped to rRNA reference using backtrack but was not mapped using mem.
backtrack:
GS85516-FS3:L02C002R005.7860.0 0 hsa_rRNA_EU597543_650:1603:+ 519 0 28M * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#) XT:A:R NM:i:1 X0:i:5519 XM:i:1 XO:i:0 XG:i:0 MD:Z:27T0
mem:
GS85516-FS3:L02C002R005.7860.0 4 * 0 0 * * 0 0 AAAGGACCTGGCGGTGCTTCATATCCCG ,,+/#*$#+$##$%,#)')0..1..)#)AS:i:0 XS:i:0

I am very confused. Can anyone help me with this?
demienx is offline   Reply With Quote
Old 12-16-2014, 02:05 AM   #2
Ihavenoidea
Junior Member
 
Location: Liege, Belgium

Join Date: Mar 2014
Posts: 2
Default

Hello,
I work with miRNA data and I had the same problem, bwa-mem was mapping 1-5% of my reads, but when I used backtrack, my mapping got up to 80-85%. Mem is optimized for longer reads and doesn't work well for short fragments.
Also, I have seen a lot of differences in the mapping depending on the specifity of my trimming, going from 60 to 80% with bwa-aln + samse.
Hope is of any help for u!
Ihavenoidea is offline   Reply With Quote
Old 12-16-2014, 06:51 AM   #3
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 509
Default

From the BWA-MEM abstract:

"The algorithm is robust to sequencing errors and applicable to a wide range of sequence lengths from 70bp to a few megabases."

The length of your example is 28bp - too short for this tool.
HESmith is offline   Reply With Quote
Old 12-17-2014, 09:11 PM   #4
demienx
Junior Member
 
Location: China

Join Date: Oct 2014
Posts: 4
Default

Thank you Ihavenoidea. It seems very possible that the low mapping rate is due to my short read length. But could you tell me how long your miRNA read is?
demienx is offline   Reply With Quote
Old 12-17-2014, 09:27 PM   #5
demienx
Junior Member
 
Location: China

Join Date: Oct 2014
Posts: 4
Default

Hi HESmith,
I should apologize for making such a simple mistake, and thank you for pointing it out for me. I originally thought that mem was suitable for a wider range of read length than backtrack.
demienx is offline   Reply With Quote
Old 12-17-2014, 11:51 PM   #6
Ihavenoidea
Junior Member
 
Location: Liege, Belgium

Join Date: Mar 2014
Posts: 2
Default

Quote:
Originally Posted by demienx View Post
Thank you Ihavenoidea. It seems very possible that the low mapping rate is due to my short read length. But could you tell me how long your miRNA read is?
After efficiently trimming my samples are of about 20pbs
Ihavenoidea is offline   Reply With Quote
Reply

Tags
bwa mem

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:19 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO