SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Adapters for Nextera Mate Pair Library Prep Kit lu_Ste Illumina/Solexa 1 10-10-2018 09:30 PM
New kit: Nextera DNA-Flex Genetic Librarian Sample Prep / Library Generation 7 02-01-2018 10:56 AM
TruSeq or Nextera kit for library prep? rooty Sample Prep / Library Generation 12 10-29-2013 06:02 AM
low DNA conc after amplification -DNA library prep dummyseq Illumina/Solexa 2 01-25-2013 11:26 AM
Amplification of ChIP'd DNA before library prep OptimusBrien Sample Prep / Library Generation 1 07-12-2012 12:26 PM

Reply
 
Thread Tools
Old 04-03-2019, 01:30 AM   #1
Rosmano
Member
 
Location: Portugal

Join Date: May 2012
Posts: 12
Default Unable to do library amplification using the new Nextera DNA Flex Library Prep kit

Hello everyone,

I am trying to do a library of FACS sorted T-cells using the new Nextera DNA Flex Library Prep kit to perform ATAC-seq.
We are using adapters ordered from Sigma that have the same sequence as the Illumina ones:

Ad1 - AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Ad 2.1 - CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Ad 2.2 - CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT

I've already tested the following parameters:
- Tested different amounts of cells - 25k, 50k, 75k;
- Removed the final bead purification step and changed it by a MinElute column purification - when I performed this, my Bioanalyzer profile showed an enormous amount of adapter dimers and no library amplification at all;

Finally, Illumina had the following information in their page for the discontinued Nextera DNA Library Prep Kit:

Quote:
The Nextera DNA Library Prep Kit has been obsolesced. For whole-genome sequencing, Nextera DNA Flex Library Prep Kit is the recommended replacement product. For ATAC-seq and other custom applications, contact your local Illumina Sales representative to order stand-alone components TDE1 Tagment DNA Enzyme (Catalog No. 15027865) and TD Tagment DNA Buffer (Catalog No. 15027866). Illumina remains committed to providing you with high-quality support and service.
However, they've since made that page redirect to the new kit and now that information is no longer available. Has anyone been able to make the kit work?
Rosmano is offline   Reply With Quote
Old 04-03-2019, 02:04 AM   #2
Rosmano
Member
 
Location: Portugal

Join Date: May 2012
Posts: 12
Default

As an update, I contacted Illumina and they said they haven't text the Nextera DNA flex kit for ATAC-seq.

Or if anyone has any suggestion of an alternative kit that I can use I would welcome such a suggestion.
I know I can order the TDE1 enzyme and TD bufer directly from Illumina but I am willing to study alternatives since apparently they're not interested in providing an easy way to obtain these reagents, which is a pity since I want to follow the Buenruostro protocol (or the Omni-ATAC one).

Last edited by Rosmano; 04-03-2019 at 02:08 AM.
Rosmano is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:09 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO