SEQanswers

Go Back   SEQanswers > Applications Forums > Genomic Resequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
RNA-Seq simulation Zimbobo Bioinformatics 17 08-06-2014 06:30 AM
velveth assembly with single and paired ends Apexy RNA Sequencing 0 08-05-2011 09:41 AM
dwgsim usage gprakhar Bioinformatics 18 07-12-2011 09:59 AM
Simulation package in R Jasmine Bioinformatics 0 07-05-2011 09:27 AM
ChIP-Seq Simulation golharam Bioinformatics 3 08-07-2010 12:56 PM

Reply
 
Thread Tools
Old 11-03-2011, 01:35 AM   #1
kaile
Junior Member
 
Location: Beijing

Join Date: Nov 2011
Posts: 2
Question dwgsim for single ends simulation

I want to use the dwgsim tool to do single end reads simulation, but i found
the tools can't do generate the single end reads. such as:
The input command is:
dwgsim -N 10000 -r 0.001 -1 100 ~/db/genome/hg18.fa r0.fq
The output file is:
r0.fq.bfast.fastq
r0.fq.bwa.read1.fastq
r0.fq.bwa.read2.fastq
I also checked the content of the fastq files:
r0.fq.bwa.read1.fastq
@chr1_203458592_203459164_0_1_0_0_3:0:0_2:0:0_0/1
AGAGCAGAACTCTGTCTCAAAAAAAAAAAAAGAAAGAAAGAAGGTTTACAAATTTGTGTTGGGCCTCATTCAAAGCCGTCCTGGGCTGCGTGCGGCCGGT
### 100bp
r0.fq.bwa.read2.fastq
@chr1_203458592_203459164_0_1_0_0_3:0:0_2:0:0_0/2
TCCTCTGTAATGGGAGAAAAAATGATAATCATGGCCATGAACAGAGGAGGACTGTGAAGTGTAAACTTAA
### default 70bp
Is there anyone tell me why the software gives two bwa reads which don't
like the single end reads and how I get the single end reads using the
dwgsim ?Thanks!
kaile is offline   Reply With Quote
Old 11-05-2011, 07:41 AM   #2
nilshomer
Nils Homer
 
nilshomer's Avatar
 
Location: Boston, MA, USA

Join Date: Nov 2008
Posts: 1,285
Default

Quote:
Originally Posted by kaile View Post
I want to use the dwgsim tool to do single end reads simulation, but i found
the tools can't do generate the single end reads. such as:
The input command is:
dwgsim -N 10000 -r 0.001 -1 100 ~/db/genome/hg18.fa r0.fq
The output file is:
r0.fq.bfast.fastq
r0.fq.bwa.read1.fastq
r0.fq.bwa.read2.fastq
I also checked the content of the fastq files:
r0.fq.bwa.read1.fastq
@chr1_203458592_203459164_0_1_0_0_3:0:0_2:0:0_0/1
AGAGCAGAACTCTGTCTCAAAAAAAAAAAAAGAAAGAAAGAAGGTTTACAAATTTGTGTTGGGCCTCATTCAAAGCCGTCCTGGGCTGCGTGCGGCCGGT
### 100bp
r0.fq.bwa.read2.fastq
@chr1_203458592_203459164_0_1_0_0_3:0:0_2:0:0_0/2
TCCTCTGTAATGGGAGAAAAAATGATAATCATGGCCATGAACAGAGGAGGACTGTGAAGTGTAAACTTAA
### default 70bp
Is there anyone tell me why the software gives two bwa reads which don't
like the single end reads and how I get the single end reads using the
dwgsim ?Thanks!
Use "-2 0" to specify the second end should have length zero, since otherwise it uses the defaults.
nilshomer is offline   Reply With Quote
Old 11-05-2011, 06:06 PM   #3
kaile
Junior Member
 
Location: Beijing

Join Date: Nov 2011
Posts: 2
Default

Quote:
Originally Posted by nilshomer View Post
Use "-2 0" to specify the second end should have length zero, since otherwise it uses the defaults.
Thanks! And I have already received your email on replying my question, you are so nice!
kaile is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO