SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to convert BAM file into dosage array data Mike_Brown Bioinformatics 1 01-01-2016 03:10 PM
Extract reference and aligned sequences from BAM file basing on VCF file floem7 Bioinformatics 3 01-19-2015 03:08 AM
multiple vcf files to one multisampled vcf file Jetse Bioinformatics 2 06-27-2013 05:34 AM
How to get list of column in vcf file using Vcf.pm? jessada Bioinformatics 0 01-20-2012 07:22 AM

Reply
 
Thread Tools
Old 03-15-2017, 06:43 AM   #1
olavur
Junior Member
 
Location: Tˇrshavn, Faroe Islands

Join Date: Mar 2017
Posts: 2
Default Spurious dosage coefficient of determination in imputed VCF file

I have a VCF file that has dosage r^2 in the info field. The problem is that while the r^2 value should be in the 0 to 1 range, it has both negative values and values above 1.

Is there a fundamental problem with my data? I might add that this is whole-exome data where the off-target regions have been imputed using Beagle.

I have pasted some data collected from VCFtools, just to give an example. As you can see there are huge numbers (positive and negative), and a lot of zeros.

Dosage r^2 example:
CHROM POS REF ALT DR2
1 10177 A AC 0
1 10235 T TA 0
1 10352 T TA 0
1 10616 CCGCCGTTGCAAAGGCGCGCCG C 0.01
1 10642 G A 0
1 11008 C G 0.01
1 11012 C G 0.01
1 11063 T G 0


More dosage r^2 examples:
One allele with dr2=0, one with a huge number:
1 66381 TATATA AATATA,T 0,5.10663e+28
One with high correlation, another with a huge (negative) number:
1 769829 C A,G 0.82,-7.97911e+26
Also really tiny numbers, which is plausible, but suspicious:
1 15274 A G,T 0,3.66383e-14
olavur is offline   Reply With Quote
Reply

Tags
dosage, r-squared, vcf, vcftools

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO