[SDPA_Pet]

First point: sequencing is always 5'->3' (that's the directionality of DNA polymerase).

Second point: Illumina read 1 and read 2 are derived from the opposite ends and opposite strands of your amplicon.

Third point: If you're using standard sequencing primers, the beginning of read 1 and read 2 will exactly match your amplicon primers.

So let's look at your primers and read data. The beginning of read 1 matches primer 519R:

NTGTTACTGCGGCGGCTG read1
GTNTTACNGCGGCKGCTG 519R


And read 2 matches the barcode plus primer 27F:

CGTAACCAAGAGTTTGATCCTGGCTCAG read2
CGTAACCAAGRGTTTGATCMTGGCTCAG barcode+27F

As I said, it's always easier to explain when the data are available.

-Harold

Thanks. I think the non-traditional nucleotides make me confused.

BTW, Should R1 always use forward primer and R2 use reversed primer? Does illumina have any rules? Or it doesn't matter.

My first read is from R1 fastq file but it begins with reverse primer. The 2nd read is from R2 fastq file and begins with forward primer.

[HESmith]

BTW, Should R1 always use forward primer and R2 use reversed primer? Does illumina have any rules? Or it doesn't matter.

You're confusing your amplicon primers with Illumina's adaptor/sequencing primers. Any correlation b/t read 1 and your amplicon primer depends upon how the library was constructed. If the adaptors were added by ligation, then the amplicon can be in either orientation (i.e., read 1 data can start from either end of the amplicon). If the adaptors were added by PCR, then all of the read 1 data will start from the same end of the amplicon. But, depending upon how the adaptor PCR primers were designed, that could be either the forward or reverse amplicon primer.

[SDPA_Pet]

Hi HeSmith,

It seems mine was not added during PCR. It is by ligation?

Someone posted this for me upper (http://www.illumina.com/content/dam/..._miseq_16S.pdf)

It seems this manual use the PCR methods. According this method, forward PCR primer amplified reads are always R1.

[HESmith]

I cannot tell you how your libraries were constructed. You need to contact the individual who made them.