bowtie2 outputs empty file

leontp587 · 08-11-2014, 01:23 PM

I'm trying to align a paired reads fastq file to the hg19 genome using bowtie2 in Galaxy. The paired ends files are the output of a fastq groomer and are about 3GB each and contains reads like these:

@ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76
AGTTATGATTTTTGTTAGTCTTTTTGTCTTATTATTCTTCCTTAGGATTATAACAACTACTCTAACCTTTTGTTCT
+ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76
!"""!""!""""""""!"!"""""""!"""""""""""""""""""""!!"!"""!!"!!!!!!!!!!!!!!!!!!

The bowtie2 syntax as run by galaxy is:
bowtie2-build "/home/leon/ref_data/fa/hg19.fa" genome; ln -s "/home/leon/ref_data/fa/hg19.fa" genome.fa; bowtie2 -p ${GALAXY_SLOTS:-4} -x genome -1 /home/leon/galaxy-dist/database/files/000/dataset_19.dat -2 /home/leon/galaxy-dist/database/files/000/dataset_20.dat -I 0 -X 250 | samtools view -Su - | samtools sort -o - - > /home/leon/galaxy-dist/database/files/000/dataset_21.dat

For some reason, the bam file that's generated after this runs for several hours is only 62 bytes long, meaning nothing got aligned! What could I be doing wrong? This is the first time I'm aligning a genome and so could be royally screwing things up.

westerman · 08-12-2014, 07:51 AM

Probably better to post this to the Galaxy forum.

I am unsure which Galaxy instance you are using but my first observation is that you are trying to build the index for a commonly used genome -- hg19. Why not use the built-in index? My suspicion is that if you are using the public Galaxy instance that you are running out disk space or time when building the index.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Repost: tophat-fusion outputs empty result	mrfox	Bioinformatics	31	10-13-2016 08:03 AM
Tophat2 returns empty junction file: Warning: junction database is empty!	sachitad	Bioinformatics	4	02-15-2013 01:40 AM
bwa question on file outputs/inputs	ikrier	Bioinformatics	12	10-12-2012 09:22 AM
the meaning of CIGAR column in SAM file outputs by BWA	holywoool	Bioinformatics	2	01-04-2011 05:34 AM
Aligner that outputs H2 flag in SAM file	phalaenopsis	Bioinformatics	0	08-04-2010 06:14 AM

08-11-2014, 01:23 PM	#1
leontp587 Junior Member Location: US Join Date: Jul 2014 Posts: 6	bowtie2 outputs empty file I'm trying to align a paired reads fastq file to the hg19 genome using bowtie2 in Galaxy. The paired ends files are the output of a fastq groomer and are about 3GB each and contains reads like these: @ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76 AGTTATGATTTTTGTTAGTCTTTTTGTCTTATTATTCTTCCTTAGGATTATAACAACTACTCTAACCTTTTGTTCT +ERR010982.1460.2 SOLEXA-GA01_1:1:1:21:1187 length=76 !"""!""!""""""""!"!"""""""!"""""""""""""""""""""!!"!"""!!"!!!!!!!!!!!!!!!!!! The bowtie2 syntax as run by galaxy is: bowtie2-build "/home/leon/ref_data/fa/hg19.fa" genome; ln -s "/home/leon/ref_data/fa/hg19.fa" genome.fa; bowtie2 -p ${GALAXY_SLOTS:-4} -x genome -1 /home/leon/galaxy-dist/database/files/000/dataset_19.dat -2 /home/leon/galaxy-dist/database/files/000/dataset_20.dat -I 0 -X 250 \| samtools view -Su - \| samtools sort -o - - > /home/leon/galaxy-dist/database/files/000/dataset_21.dat For some reason, the bam file that's generated after this runs for several hours is only 62 bytes long, meaning nothing got aligned! What could I be doing wrong? This is the first time I'm aligning a genome and so could be royally screwing things up.

08-12-2014, 07:51 AM	#2
westerman Rick Westerman Location: Purdue University, Indiana, USA Join Date: Jun 2008 Posts: 1,104	Probably better to post this to the Galaxy forum. I am unsure which Galaxy instance you are using but my first observation is that you are trying to build the index for a commonly used genome -- hg19. Why not use the built-in index? My suspicion is that if you are using the public Galaxy instance that you are running out disk space or time when building the index.