SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Samtools Mac Install jlc_1020 Bioinformatics 35 05-09-2014 08:52 AM
Install Dindel on Mac yinshe Bioinformatics 8 11-08-2013 09:18 AM
Staden install on Mac OSX 10.6 andreitudor Bioinformatics 0 04-07-2011 06:29 AM
How to install GAPapiline on MAC zcsbldm Bioinformatics 4 11-03-2009 06:46 PM
How to install tffind in Mac zimu General 0 01-09-2009 03:44 AM

Reply
 
Thread Tools
Old 11-27-2011, 10:41 AM   #1
joseph
Member
 
Location: ca

Join Date: Feb 2008
Posts: 39
Default help to install 'FAR - The Flexible Adapter Remover' on Mac OS

can you please show me how to install FAR on Mac OS?
I was not able to install it when I followed the instructions in Readme.txt
http://sourceforge.net/apps/mediawik...itle=Main_Page
Thanks
Joseph
joseph is offline   Reply With Quote
Old 11-27-2011, 11:06 AM   #2
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

Maybe report what errors you encountered...?
ECO is offline   Reply With Quote
Old 11-27-2011, 12:45 PM   #3
joseph
Member
 
Location: ca

Join Date: Feb 2008
Posts: 39
Default

Quote:
Originally Posted by ECO View Post
Maybe report what errors you encountered...?
these are the instructions from Readme.txt:
MacOSX: Copy the libtbb.dylib from ./lib into your lib searchpath.

I copied ibtbb.dylib to /usr/local/bin
but I am not able to figure out from the instructions what are the next steps after copying this file to /usr/local/bin.

I tried to run it:
far --adapters adapters.fasta --source test.fa --target test_result.fa --format fasta --log-level ALL --cut-off 4 --min-overlap 6
-bash: far: command not found

thanks
joseph is offline   Reply With Quote
Old 11-27-2011, 04:49 PM   #4
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,358
Default

I can't get it to run either. Seems there are either files missing and/or it's not compiled correctly for OSX...shame, seems like a cool utility!
ECO is offline   Reply With Quote
Old 11-28-2011, 01:31 AM   #5
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

Quote:
Originally Posted by ECO View Post
I can't get it to run either. Seems there are either files missing and/or it's not compiled correctly for OSX...shame, seems like a cool utility!
Guys, where's the OS X binary? Anyway, I'm trying to build my own TBB and FAR. Meanwhile, you should check if link path of libtbb.dylib is properly set:

Code:
$ otool -L libtbb.dylib
The first line should be the path you want it to be (i.e. /usr/local/lib). You may change it by

Code:
$ install_name_tool -id /usr/local/lib/libtbb.dylib libtbb.dylib
In precompiled far you should change it by issuing

Code:
$ install_name_tool -change /path/to/libtbb.dylib /usr/local/lib/libtbb.dylib far
This hopefully should work (although it is hard to guess without the error you get).
@joseph: your far installation should be in a directory in the PATH env variable :-)
dawe is offline   Reply With Quote
Old 11-28-2011, 01:46 AM   #6
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

BTW, build from source works. If you need a precompiled binary I can provide one.
dawe is offline   Reply With Quote
Old 11-28-2011, 09:31 AM   #7
joseph
Member
 
Location: ca

Join Date: Feb 2008
Posts: 39
Default

Quote:
Originally Posted by dawe View Post
BTW, build from source works. If you need a precompiled binary I can provide one.
yes, please send me a precompiled binary.
Thank you.
Joseph
joseph is offline   Reply With Quote
Old 11-28-2011, 11:37 PM   #8
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

Quote:
Originally Posted by joseph View Post
yes, please send me a precompiled binary.
Thank you.
Joseph
You can download it here. Uncompress in /usr/local:

Code:
sudo tar xvzf far.tgz -C /usr/local
it should be working.

d
dawe is offline   Reply With Quote
Old 11-29-2011, 06:53 AM   #9
kga1978
Senior Member
 
Location: Boston, MA

Join Date: Nov 2010
Posts: 100
Default

Hey dawe,

Thanks for uploading the binary - very helpful!

Last edited by kga1978; 11-29-2011 at 07:06 AM. Reason: Idiotic question.... forgot that .gz isn't supported
kga1978 is offline   Reply With Quote
Old 11-29-2011, 07:47 AM   #10
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

AFAIK it doesn't understand gzipped fastq. You should try with a subshell, i.e.
Code:
far -s <(zcat G676_subsampled.fastq.gz) -f fastq -o 6 -th 6 -a contaminants.fasta -t stdout
dawe is offline   Reply With Quote
Old 12-02-2011, 01:56 PM   #11
joseph
Member
 
Location: ca

Join Date: Feb 2008
Posts: 39
Default

Quote:
Originally Posted by dawe View Post
You can download it here. Uncompress in /usr/local:

Code:
sudo tar xvzf far.tgz -C /usr/local
it should be working.

d
It works. Thank you.
joseph is offline   Reply With Quote
Old 12-03-2011, 12:25 AM   #12
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

I tried to install dawe's precompiled binary (Thanks for sharing!!!). It is for OSX correct?
I ran:
Code:
sudo tar xvzf far.tgz -C /usr/local
Then I made a couple short test files if fasta format because it is the most simple.

And this is what I get:
Code:
$ far -s fartest.fasta -t fartestout.fa -f fasta -a IlluminaAdapters.fa
source file was set to fartest.fasta.
No 2nd input file specified! (Run is not paired)

target file was set to fartestout.fa.
File format was set to FASTA
Will do demultiplexing and adapter removal... 
Adapter file: IlluminaAdapters.fa

Nr. of allowed indels + mismatches per 10 bases: 2

Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Segmentation fault
Not sure what a segmentation fault is, but could it be that the precompiled binary dawe posted isn't exactly right for my computer?
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 12-03-2011, 08:21 AM   #13
joseph
Member
 
Location: ca

Join Date: Feb 2008
Posts: 39
Default

Hi Ethan
it worked fine for me

Code:
 far --source myfile.fastq --target myoutput.fastq --format fastq --adapters adapters.fasta --nr-threads 4 

far --source SRR309288.fastq --target SRR309288_far_trim --format fastq --adapters adapter.fa --nr-threads 2 
source file was set to SRR309288.fastq.
No 2nd input file specified! (Run is not paired)
target file was set to SRR309288_far_trim.
File format was set to FASTQ-illumina15
Will do demultiplexing and adapter removal... 
Adapter file: adapter.fa
Nr. of allowed indels + mismatches per 10 bases: 2
Allowed number of uncalled bases was set to 0
Chosen scoring scheme: match = 3 ,mismatch = -3 ,gap opening = -20
Trimming from right end. 
Minimum required overlap: 10
Overlap will be treated as standard overlap. 
Adapter sequences are:
adapter
TCGTATGCCGTCTTCTGCTTGT
No barcodes file specified... 
Minimum required readlength: 18
Using 2 threads.
Writing omitted read ids to: SRR309288.fastq.omitted
Using no phred-quality trimming.
Starting processing (algorithm: needleman-wunsch)...
Done.
Calculation Time: 28 minutes 53 seconds. 
Step 1 - filtering input files: 
=============================== 
Input file contained 13823407 reads.
Discarded in total 309069 reads due to containing uncalled bases.
Discarded in total 0 reads due to having low quality.
Used      13823407 reads from input file.
12037203 reads remaining ( 85.1741 % of input reads )
Statistics on each output file:
===============================
File: SRR309288_far_trim.fastq
Nr. of reads dropped due to being shorter than minLength: 1477135
Nr. of reads written to the file: 12037203
Writing length distributions of reads (for each file) 
Statistics on adapter removal (input files):
============================================
Adapter	removal_count
adapter	10847050
Min-/Max-/Mean-/Median-overlap length: 10 / 23 / 12 / 11
these are the files:
Code:
> head -20 SRR309288.fastq
@SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.1 ILLUMINA-432AEC_0016:4:1:959:1667 length=36
####################################
@SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
NNNNNNNNCNNNNNNTATGCCGTCTTCGGCTTGCAA
+SRR309288.2 ILLUMINA-432AEC_0016:4:1:959:8156 length=36
####################################
@SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
NNNNNNNNCNNNNTNATGTTGACATCTCGTATGCCG
+SRR309288.3 ILLUMINA-432AEC_0016:4:1:959:1631 length=36
####################################
@SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
NNNNNNNNCNNANANCATCTCGTATGCCGTCTTCTG
+SRR309288.4 ILLUMINA-432AEC_0016:4:1:960:2745 length=36
########(##'#1#4366.???>><>?>???>?>7
@SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
NNNNNNNNTNNANTNAGAAGGCATCTCGTATGCCGT
+SRR309288.5 ILLUMINA-432AEC_0016:4:1:960:1472 length=36
####################################


> head -20 SRR309288_far_trim
head: SRR309288_far_trim: No such file or directory
boyce-162-119:FAR jdhahbi$ head -20 SRR309288_far_trim.fastq
@SRR309288.531 ILLUMINA-432AEC_0016:4:1:1019:15214 length=36
CACCCGTAGAACCGACCTTGCATC
+
GFEGGFFAFDAECDCFFFDFEEGE
@SRR309288.532 ILLUMINA-432AEC_0016:4:1:1019:12253 length=36
CTGAGCCGAGAATGGGGATC
+
FF5FFFDFEDBADDD-DCAD
@SRR309288.533 ILLUMINA-432AEC_0016:4:1:1019:9688 length=36
GCATTGTGGTTCAGTGGTAGAATTCTCGATCTCGTA
+
:E?EEAEEEEBE?D?EEA?ED=DEE5EE-:DD-DDA
@SRR309288.534 ILLUMINA-432AEC_0016:4:1:1019:6554 length=36
TAGCTTATCAGACTGATGTTGACATC
+
FGGGGGGFGDEGGGGGGGGGFGGGGG
@SRR309288.535 ILLUMINA-432AEC_0016:4:1:1019:15771 length=36
TAGCTTATCAGACTGATGTTGACATC
+
GFGFFFA?DFE-BEDBFDFFF?F:EF
joseph is offline   Reply With Quote
Old 12-03-2011, 08:34 AM   #14
ETHANol
Senior Member
 
Location: Western Australia

Join Date: Feb 2010
Posts: 308
Default

Okay, I'm stupid. Little mistake in my adapter file. Thanks for the code Joseph!! It showed me where to look.
__________________
--------------
Ethan
ETHANol is offline   Reply With Quote
Old 01-17-2012, 11:24 AM   #15
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 628
Default

@All,
are you happy with FAR or are you using other tools for (illumina) adpator/quality clipping?
I am trying to figure out which is the "best" one, in terms of flexibility and good results.

Currently I am playing around with far (surely developed for Mac as the Makefile needs to be fixed for compiling on linux). It seems quite flexible, "verbose" and it works on PE data directly.

Sven
sklages is offline   Reply With Quote
Old 01-17-2012, 12:14 PM   #16
kga1978
Senior Member
 
Location: Boston, MA

Join Date: Nov 2010
Posts: 100
Default

I have moved to trimmomatic - it does SE and PE as well and in my hands much much faster.
kga1978 is offline   Reply With Quote
Old 01-17-2012, 01:05 PM   #17
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 628
Default

Quote:
Originally Posted by kga1978 View Post
I have moved to trimmomatic - it does SE and PE as well and in my hands much much faster.
FAR does SE/PE as well (starting from version 2 AFAIK).
Speed is not really a matter for me. If it takes five minutes per lane, fine, if it takes one hour, fine too (considering instrument run time and time for downstream analysis) :-)

Have you compared the results? Similar?
sklages is offline   Reply With Quote
Old 01-17-2012, 01:09 PM   #18
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

ea-utils is really fast, unfortunately lacks proper documentation
dawe is offline   Reply With Quote
Old 01-17-2012, 01:43 PM   #19
sklages
Senior Member
 
Location: Berlin, DE

Join Date: May 2008
Posts: 628
Default

Quote:
Originally Posted by dawe View Post
ea-utils is really fast, unfortunately lacks proper documentation
Yes, parameters and/or working principles are poorly documented. I agree, it is really fast.
Are you using fastq-mcf in production?
sklages is offline   Reply With Quote
Old 01-17-2012, 01:46 PM   #20
dawe
Senior Member
 
Location: 4530'25.22"N / 915'53.00"E

Join Date: Apr 2009
Posts: 258
Default

Quote:
Originally Posted by sklages View Post
Yes, parameters and/or working principles are poorly documented. I agree, it is really fast.
Are you using fastq-mcf in production?
I'm using fastq-join and fastq-mcf. The first for overlapping paired end reads, the second to de-multiplex NuGEN RNA-seq libraries.
I'm trying to get some more doc (the developer is very active...)
dawe is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:24 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO