SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Sorting fastq by primers, then searching by sequence (with mismatches) jme Bioinformatics 0 01-18-2012 09:25 AM
PubMed: Pipeline for Large-Scale Microdroplet Bisulfite PCR-Based Sequencing Allows t Newsbot! Literature Watch 0 07-14-2011 06:20 AM
Searching for Bisulfite sequencing primers aleferna Bioinformatics 3 08-09-2010 03:17 AM
PubMed: Comparison of bisulfite sequencing PCR with pyrosequencing for measuring diff Newsbot! Literature Watch 0 10-20-2009 02:00 AM
whole genome Bisulfite Sequence MAPping program wei Bioinformatics 0 08-07-2009 02:46 PM

Reply
 
Thread Tools
Old 02-26-2013, 06:26 AM   #1
kit.
Junior Member
 
Location: HK

Join Date: Feb 2013
Posts: 5
Question Searching for original genome sequence with PCR primers used for bisulfite sequencing

I have to do bisulfite sequencing and I have searched from literature that, there's primer already available for the region I am interested. I am wondering how can I got the original genome sequence that the PCR amplified?

One of the region I am interested in is H19 in chromosome 11 in human. PCR primers used for amplifying bisulfite-converted DNA was
F: 5'-TGAGTGTTTTATTTTTAGATGATTTT-3'
R: 5'-ACAATACAAACTCACACATCACAAC-3'

Is there any ways that I can search the original genome sequence (not bisulfite converted DNA sequence) that this PCR amplified?

Thanks
kit. is offline   Reply With Quote
Old 02-26-2013, 08:05 AM   #2
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 625
Default

For the GRCh37 genome build the forward sequence aligns to chr 11, starting at bp 2021077. Here is the SAM entry:
forward_oligo 0 11 2021077 255 26M * 0 0 TGAGTGTTTTATTTTTAGATGATTTT IIIIIIIIIIIIIIIIIIIIIIIIII NM:i:9 XX:Z:7CC4CCC6CCCC XM:Z:.......hh....hhx......hhhx XR:Z:CT XG:Z:CT

I am afraid the reverse primer seems to align to several different places (I think with 1 mismatch), but maybe if you start looking for in a sensible PCR distance from the forward match you'll be lucky.
fkrueger is offline   Reply With Quote
Old 02-26-2013, 08:30 AM   #3
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

Did you try in silico PCR on UCSC's genome browser?
swbarnes2 is offline   Reply With Quote
Old 02-26-2013, 03:11 PM   #4
frozenlyse
Senior Member
 
Location: Australia

Join Date: Sep 2008
Posts: 136
Default

Quote:
Originally Posted by swbarnes2 View Post
Did you try in silico PCR on UCSC's genome browser?
That won't work for bisulfite primers, unless you have a UCSC instance with bisulfite converted genomes loaded - which is annoying for human because you have to make a separate one for each strand. Personally I created BSgenome packages for bisulfite genomes and use R/Bioconductor functions for this kind of stuff.
frozenlyse is offline   Reply With Quote
Old 02-28-2013, 01:38 AM   #5
C.R.
Member
 
Location: Germany

Join Date: Jun 2010
Posts: 25
Default

You may try http://bisearch.enzim.hu/?m=genompsearch
C.R. is offline   Reply With Quote
Old 02-28-2013, 11:56 AM   #6
PeteH
Member
 
Location: Melbourne

Join Date: Jun 2010
Posts: 64
Default

Quote:
Originally Posted by frozenlyse View Post
Personally I created BSgenome packages for bisulfite genomes and use R/Bioconductor functions for this kind of stuff.
That sounds useful to me; care to share your script for creating these?
Thanks,
Pete
PeteH is offline   Reply With Quote
Old 02-28-2013, 06:15 PM   #7
kit.
Junior Member
 
Location: HK

Join Date: Feb 2013
Posts: 5
Default

Quote:
Originally Posted by fkrueger View Post
For the GRCh37 genome build the forward sequence aligns to chr 11, starting at bp 2021077. Here is the SAM entry:
forward_oligo 0 11 2021077 255 26M * 0 0 TGAGTGTTTTATTTTTAGATGATTTT IIIIIIIIIIIIIIIIIIIIIIIIII NM:i:9 XX:Z:7CC4CCC6CCCC XM:Z:.......hh....hhx......hhhx XR:Z:CT XG:Z:CT

I am afraid the reverse primer seems to align to several different places (I think with 1 mismatch), but maybe if you start looking for in a sensible PCR distance from the forward match you'll be lucky.
Yes you are correct. This primer has the potential to create mismatch when I search by http://bisearch.enzim.hu/?run. But all of them are located in chromosome 11.

Can you please give me the sequence you found with the shortest length? In literature it mentioned that it would amplify 149bp but I found 125bp only using the website I posted. I just don't know where there's such as difference.
kit. is offline   Reply With Quote
Old 02-28-2013, 06:18 PM   #8
kit.
Junior Member
 
Location: HK

Join Date: Feb 2013
Posts: 5
Default

Quote:
Originally Posted by C.R. View Post
I search the primers using the website you mentioned. It turns out that the product size is 125bp, but in literature, the same set of primers would results in a amplicon of 148bp. I am wondering why there's such a difference....
kit. is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:46 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO