SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
ChIP-Seq: AREM: Aligning Short Reads from ChIP-Sequencing by Expectation Maximization Newsbot! Literature Watch 0 11-01-2011 04:20 AM
Very high duplication of sequences in ChIP-Seq sequencing results OptimusBrien Epigenetics 8 09-15-2011 08:23 AM
short insert size in samll RNA sequencing wangzhijiao Illumina/Solexa 0 07-21-2011 10:37 PM
ChIP-Seq: A Gibbs sampling strategy applied to the mapping of ambiguous short sequenc Newsbot! Literature Watch 0 09-28-2010 03:00 AM
ChIP-Seq: Processing and analyzing ChIP-seq data: from short reads to regulatory inte Newsbot! Literature Watch 0 09-24-2010 02:10 AM

Reply
 
Thread Tools
Old 12-17-2009, 09:58 AM   #1
Nihilo
Junior Member
 
Location: Worceste

Join Date: Oct 2009
Posts: 2
Default short duplication of part of the insert ChIP-Seq

I am currently verifying the library quality of my ChIP-Seq preparation by sequencing some of the subcloned products into the TA cloning vector. Upon alignment of the insert (i.e. between the two Solexa primers), I frequently obtain a 80-90% alignment to the human genome with an extra bit of sequence that does not align. When I look at this extra sequence (usually between 4-9 nucleotides, but it can go up to 30 nucleotides), it is always complementary to the start of the insert. Here's an example:

...ttccgatctCCTTAATTxxxxxxxxxxxxxxxxxxxxxxxxxAATTAAGGagatcgg....
(end of Solexa primer) (rest of insert) (other Solexa primer)

The beginning of the insert (CCTTAATT) would align to the human genome with the rest of the insert up to the AATTAAGG sequence which would not align. In every case, this remaining sequence would be complementary to the beginning of the insert (in this case CCTTAATT). This occurs 70-80% of the time. On rare occasion, I will obtain an insert without that feature that will entirely align with the human genome. Is this normal ? What could be the cause of that ? It is always happening on the side of the Solexa PCR primer 1 (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT), regardless of the orientation of the insert in the TA cloning vector. Am I amplifying molecules that are circularized by a certain mechanism over other molecules ?

Thank you !
Nihilo is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:47 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO