SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Split Large FASTQ file in small FASTQ files with user defined number of reads Windows deepbiomed Bioinformatics 3 04-04-2013 07:14 AM
quality scores in fastq files extracted from sea files efoss Bioinformatics 3 02-01-2013 03:09 PM
Newbler outputting garbage drdna Bioinformatics 4 12-18-2012 06:23 AM
Problems with outputting GT information using samtools Rcucullatus Bioinformatics 0 09-26-2012 07:35 AM
RNA-Seq: Xenome--a tool for classifying reads from xenograft samples. Newsbot! Literature Watch 0 06-13-2012 02:40 AM

Reply
 
Thread Tools
Old 06-03-2014, 08:13 AM   #1
Seq^3
Junior Member
 
Location: US

Join Date: Nov 2010
Posts: 3
Default Xenome not outputting FASTQ formatted files?

Any users of Xenome run into this? You start with an input file that follows FASTQ format (line 1 begins with @ and line 3 begins with +):
Code:
@HISEQ03:124:C3R2RACXX:5:1101:2218:1990 1:N:0:TGACCA
ATGCNAACTACATTGCCTGGTGTCAAGGTGGGAAAATCCTCTTTTATAACATAAAATCCTCTTCTAATCCATGTTGACCCAAGTCCTGGCTGTCTGAGGG
+
<BBF#0BBFFFFFFFFIIBFFFBFFBFF<FFFIFFFFF<FFBFIIFFFFFFIIFFFIIIIIIIIIIBFIFFFFFFBFFBFFFFBBBBBBBB<BBBBBBBB
but the output loses the @ and + and is then not recognized by Tophat and probably other programs:
Code:
HISEQ03:124:C3R2RACXX:5:1101:2218:1990 1:N:0:TGACCA
ATGCNAACTACATTGCCTGGTGTCAAGGTGGGAAAATCCTCTTTTATAACATAAAATCCTCTTCTAATCCATGTTGACCCAAGTCCTGGCTGTCTGAGGG

<BBF#0BBFFFFFFFFIIBFFFBFFBFF<FFFIFFFFF<FFBFIIFFFFFFIIFFFIIIIIIIIIIBFIFFFFFFBFFBFFFFBBBBBBBB<BBBBBBBB
Is there some reason here that I don't understand for the output files to lose this?

Thanks!
Seq^3 is offline   Reply With Quote
Old 06-05-2014, 02:35 PM   #2
Seq^3
Junior Member
 
Location: US

Join Date: Nov 2010
Posts: 3
Default

Well I just added an awk script to the end of it that looks like this. Hacky but it works:
Code:
awk '{if (NR % 4 == 1) print \"@\"$0; else if (NR % 4 == 3) print \"+\"$0; else print $0 }'
Seq^3 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:25 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO