SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Question about stand alone blast for linux tarias Bioinformatics 1 04-09-2015 03:00 AM
Galaxy in Linux NGS_New_User Bioinformatics 2 08-13-2013 02:38 AM
Genomestudion in Linux Mindbomb Bioinformatics 1 04-22-2013 08:04 AM
BLASTP on linux syintel87 Bioinformatics 5 02-28-2013 08:29 AM
New to Linux and Bioinformatics johnadam33 Bioinformatics 12 09-08-2011 12:40 PM

Reply
 
Thread Tools
Old 09-01-2015, 01:30 AM   #1
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default Linux question

I have a complete genome sequence fasta file. (seq.fasta)

Like this (but tens of lines):

AAGGGGCGGCGGCGGGGTTTGTTT
TTTTGGGGCGGGCTTGAGGAGGGG
CCGGTTAGGGACCGTTGGCCGGGC
...

I want to make it like this:

read1
AAGGGGCGGCGGCGGGGTTTGTTT
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFF
read2
TTTTGGGGCGGGCTTGAGGAGGGG
+
FFFFFFFFFFFFFFFFFFFFFFFFFFFF

how can I do that in Ubuntu terminal?
Saeideh is offline   Reply With Quote
Old 09-01-2015, 02:21 AM   #2
Michael.Ante
Senior Member
 
Location: Vienna

Join Date: Oct 2011
Posts: 123
Default

Hi Saeideh,

awk would be my program of choice:
Code:
awk '{printf "read%d\n%s\n+\nFFFFFFFFFFFFFFFFFFFFFFFFFFFF\n",NR,$1}' seq.fasta > seq.fastq
This will only work if the sequences have all the same length; otherwise you need to adept the length of the quality string.
Maybe reformat.sh from bbmap could also do the job.
Michael.Ante is offline   Reply With Quote
Old 09-01-2015, 02:33 AM   #3
Saeideh
Member
 
Location: Iran

Join Date: Aug 2015
Posts: 25
Default Done~

It worked for meeee. Thank you Michaeeeeeeeeeeeel ~~~
Saeideh is offline   Reply With Quote
Old 09-01-2015, 07:16 AM   #4
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

What are you doing? It looks almost like FASTQ output with dummy quality scores of F, but missing the @ marker.
maubp is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO